The Flat Earth Society

Flat Earth Discussion Boards => Flat Earth Believers => Topic started by: Ichimaru Gin :] on November 02, 2010, 12:39:01 PM

Title: James, LW, and JD (and others if interested)
Post by: Ichimaru Gin :] on November 02, 2010, 12:39:01 PM
Please PM me your respective emails (not FES ones though). I have about 10 pages of data I would like to share with you guys.
Title: Re: James, LW, and JD (and others if interested)
Post by: Lord Wilmore on November 02, 2010, 12:56:36 PM
Done.
Title: Re: James, LW, and JD (and others if interested)
Post by: Ichimaru Gin :] on November 02, 2010, 01:01:21 PM
To check my work See Source:
LOCUS       CP000058             5928787 bp    DNA     circular BCT 01-FEB-2010
DEFINITION  Pseudomonas syringae pv. phaseolicola 1448A, complete genome.
ACCESSION   CP000058 AAEZ01000000 AAEZ01000001-AAEZ01000028
VERSION     CP000058.1  GI:71553748
DBLINK      Project: 12416
KEYWORDS    .
SOURCE      Pseudomonas syringae pv. phaseolicola 1448A
  ORGANISM  Pseudomonas syringae pv. phaseolicola 1448A
            Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales;
            Pseudomonadaceae; Pseudomonas; Pseudomonas savastanoi.
REFERENCE   1  (bases 1 to 5928787)
  AUTHORS   Joardar,V., Lindeberg,M., Jackson,R.W., Selengut,J., Dodson,R.,
            Brinkac,L.M., Daugherty,S.C., Deboy,R., Durkin,A.S., Giglio,M.G.,
            Madupu,R., Nelson,W.C., Rosovitz,M.J., Sullivan,S., Crabtree,J.,
            Creasy,T., Davidsen,T., Haft,D.H., Zafar,N., Zhou,L., Halpin,R.,
            Holley,T., Khouri,H., Feldblyum,T., White,O., Fraser,C.M.,
            Chatterjee,A.K., Cartinhour,S., Schneider,D.J., Mansfield,J.,
            Collmer,A. and Buell,C.R.
  TITLE     Whole-genome sequence analysis of Pseudomonas syringae pv.
            phaseolicola 1448A reveals divergence among pathovars in genes
            involved in virulence and transposition
  JOURNAL   J. Bacteriol. 187 (18), 6488-6498 (2005)
   PUBMED   16159782
REFERENCE   2  (bases 1 to 5928787)
  AUTHORS   Joardar,V., Lindeberg,M., Jackson,R., Selengut,J., Dodson,R.,
            Brinkac,L.M., Daugherty,S.C., DeBoy,R.T., Durkin,A.S., Giglio,M.G.,
            Madupu,R., Nelson,W.C., Rosovitz,M.J., Sullivan,S.A., Crabtree,J.,
            Creasy,T., Davidsen,T.M., Haft,D.H., Zafar,N., Zhou,L., Halpin,R.,
            Holley,T., Khouri,H.M., Feldblyum,T.V., White,O., Fraser,C.M.,
            Chatterjee,A.K., Cartinhour,S., Schneider,D., Mansfield,J.,
            Collmer,A. and Buell,R.
  TITLE     Direct Submission
  JOURNAL   Submitted (31-MAR-2005) The Institute for Genomic Research, 9712
            Medical Center Dr, Rockville, MD 20850, USA
REFERENCE   3  (bases 1 to 5928787)
  AUTHORS   Joardar,V., Lindeberg,M., Jackson,R., Selengut,J., Dodson,R.,
            Brinkac,L.M., Daugherty,S.C., DeBoy,R.T., Durkin,A.S., Giglio,M.G.,
            Madupu,R., Nelson,W.C., Rosovitz,M.J., Sullivan,S.A., Crabtree,J.,
            Creasy,T., Davidsen,T.M., Haft,D.H., Zafar,N., Zhou,L., Halpin,R.,
            Holley,T., Khouri,H.M., Feldblyum,T.V., White,O., Fraser,C.M.,
            Chatterjee,A.K., Cartinhour,S., Schneider,D., Mansfield,J.,
            Collmer,A. and Buell,R.
  TITLE     Direct Submission
  JOURNAL   Submitted (12-DEC-2006) The Institute for Genomic Research, 9712
            Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Amino acid sequence updated by submitter
REFERENCE   4  (bases 1 to 5928787)
  AUTHORS   Lindeberg,M.
  TITLE     Direct Submission
  JOURNAL   Submitted (19-DEC-2008) Dept. of Plant Pathology, Cornell
            University, Plant Science Building, Ithica, NY 14853, USA
  REMARK    Protein update by submitter
Title: Re: James, LW, and JD (and others if interested)
Post by: Ichimaru Gin :] on November 02, 2010, 01:03:36 PM
http://www.ncbi.nlm.nih.gov/nucleotide/71553748?report=genbank&log$=nuclalign&blast_rank=2&RID=D0VBUCY701N
^Used as template comparison.
Feel free to double check how it was all written.
Title: Re: James, LW, and JD (and others if interested)
Post by: Ichimaru Gin :] on November 02, 2010, 01:05:02 PM
As for my own findings, I'm emailing you now LW.
Title: Re: James, LW, and JD (and others if interested)
Post by: Lord Wilmore on November 02, 2010, 01:13:51 PM
Ichi, I'm just scanning now and probably won't be able to give this a full read until tomorrow, but it sounds truly exciting!
Title: Re: James, LW, and JD (and others if interested)
Post by: Ichimaru Gin :] on November 03, 2010, 09:15:17 AM
Raw input before Clustal W analysis
(Just in case anyone is wondering, I'm using Fasta formatting)
Quote
>sequence ref
AAAACACCTGCATGTCTGACCACGAGCTCTGGTCCGCGGCCTTGTCGTAGCCGATGTCCGGGCCGCCGTGTTCGCCGTGGCTCAGGCGGTCGGCGTCGGGGTTGGTGAAGCCGTGTTTGGCGCCGTCGATGCTGACGAATTTATAGTCTGCCTTGGCGTCGTCCATTTCCTTCTTGAAGGCGGCGACGTTCTCCGGTGTGACCATGCTGTCCTTGGCACCATGCTCGACCAGCATTGGCACTTTGATGCCCGGTTTGGCCGGGCTATTGGTGAACAGTGCGCCGTGGAAGCTGACCACGCCCAGCAACGGTTCGCCGCGACGGGCCGCGTCCAGCACGATCTTGCCGCCGAAGCAGTAACCCACCGCTGCAATCTTTTTCGGGTCGGTCTGCGGTTGTTTCTTCAATTGCTCAAGCCCGGCATCAAAGCGCTTGTCGGCCGCATCGCTGTCCTTGAGCGCGGCCTGCATGAAGGCCATCGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCGCCGTACATGTCGATGGCCATGGCGCTGTAACCCAGTGCCGCCAGATCACGGGCGCGGCGCTTGGCGTAGTCGTTCAGGCCCCACCACTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTAGTAACCCACCAGTTTTGTACCGTCGGCACTTTTGTAATCGATCTGCTCGGTCTTGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCACAAGCGCATGTTCAGCTCCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGATAGCCGATTCTGCCGCCTGCGGCGCGCACGACTGTTCAGCGCCGGTTCATCGCGTGTTCAGTCGGGGTTCAGCCCGGCGCGATTACTGTTGAGCCGTACCTTGACAGCGTCCCCGAGCGCAAAAGGAGTCGAAATGTTGAATCTCAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTGGCAGTGCGGCGGCGCAGGCGGGCGATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGCAAGACCAGTGAAAGGTTCGACGACGCCAACAGCTGGGGGCATGCGCTTAATGAGCAGGCGCGATCCAATGTGTCGGTGGGGACGCTTTATTCTCCGCCGGTTTACGGCAGTCTGACGGGGACTCACAATGGCGTGCCTGTCAGCCGCGAAATCCTGCTGGGCAGCTATGATGTGACACAGCCTGTGCCCGTCAGCGCCCGCCTGTTGAGTACTGAGGCGACGATGTCGTTTCAATCTTTGTCTTGAGGCTGTGATTGTGCCTGGGAGAGCTGCATGAAGTTGTTGGTAGTCGAGGATGAAGCGC
>sequence premixa
TGTCTGACCACAAGCTCTGGTCCGCGTGCCTTGTCGTAGCCGATGTCCGGGCCGCCGTGTTCGCCGTGGTGTCAGGCGGTCGGCGTCCGGGTTGGTGAAGCCGTGTTTGGCGCCGTCGATGCTGACGAATTTATAGTCTGCCTTGGCGTCATCCATTTCCTTCTTGAAGGCGGCGACGTTCTCCGGTGTGACCATGCTGTCCTTGGCACCATGCTCGACCAACATTGGCACTTTGATGCCCGGTTTGGCCGGGCTATTGGTGAACAGTGCGCCGTGCAAGCTGACCACGCCCAGCAACGGTTCGCCGCGACGGGCCACGTCCAGCACGATCTTGCCGCCGAAGCAGTAACCCACCGCTGCAATCTTTTTCGGGTCGGTCTGCGGTTGTTTCTTCAATTGCTCAAGCCCGGCATCAAAGCGCTTGTCGGCCGCATCGCTGTCCTTGAGCGCGGCCTGCATGAATGCCATCGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCCCCGTACATGTCAATGGCCATGGGGCTGTAACCCAATGCCGCCAGATCACAGGCGCGGCGCTTGGCGTAATCCTTCAGGCCCCACCACTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTACTAACCCACCAGTTTTGTACCGTCGTCACTTTTGTAATCGATCTGCTCGGTCTAGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCACGAAGCACATGTTCAGCTCCTTTCTTGGGG
>sequence premixb
GCGCTTCATCCTCGACTACCAACAACTTCATGCAGCTCTCCCAGGCACAATCACAGCCTCAAGACAAAGATTGAAACGACATCGTCGCCTCAGTACTCAACAGGCGGGCGCTGACGGGCACAGGCTGTGTCACATCATAGCTGCCCAGCAGGATTTCGCGGCTGACAGGCACGCCATTGTGAGTCCCCGTCAGACTGCCGTAAACCGGCGGAGAATAAAGCGTCCCCACCGACACATTGGATCGCGCCTGCTCATTAAGCGCATGCCCCCAGCTGTTGGCGTCGTCGAACCTTTCACTGGTCTTGCCGAACTCGATGCGGGCCACGTCAAGCCTGCCATCGCCCGCCTGCGCCGCCGCACTGCCACCCAGAAAAGCCAAGGCCAGGAAAAACTTGTTGAGATTCAACATTTCGACTCCTTTTGCGCTCGGGGACGCTGTCAAGGTACGGCTCAACAGTAATCGCGCCGGGCTGAACCCCGACTGAACACGCGATGAACCGGCGCTGAACAGTCGTGCGCGCCGCAGGCGGCAGAATCGGCTATCTTTTGACATTCGTGCTGCAccccccccccAAGAAGGAGCTGAACATGCGCTTGTGGATTGCAATGATCATGATGGGCCTGACTGGCCTCGGCCAGGCAGCGATCAAGACCGAGCAGATCGATTACAAAAGTGCCGACGGTACAAAACTGGTGGG 
>sequence premixc
ATCGCTGTCCTTGAGCGCGGCCTGCATGAAGGCCATCGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCGCCGTACATGTCGATGGCCATGGCGCTGTAACCCAGTGCCGCCAGATCACGGGCGCGGCGCTTGGCGTAGTCGTTCAGGCCCCACCACTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTAGTAACCCACCAGTTTTGTACCGTCGGCACTTTTGTAATCGATCTGCTCGGTCTTGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCACAAGCGCATGTTCAGCTCCTTCTTggggggggggTGCAGCACGAATGTCAAAAGATAGCCGATTCTGCCGCCTGCGGCGCGCACGACTGTTCAGCGCCGGTTCATCGCGTGTTCAGTCGGGGTTCAGCCCGGCGCGATTACTGTTGAGCCGTACCTTGACAGCGTCCCCGAGCGCAAAAGGAGTCGAAATGTTGAATCTCAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTGGCAGTGCGGCGGCGCAGGCGGGCGATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGCAAGACCAGTGAAAGGTTCGACGACGCCAACAGCTGGGGGCATGCGCTTAATGAGCAGGCGCGATCCAATGTGTCGGTGGGGACGCTTTATTCTCCGCCGGTTTACGGCAGTCTGACGGGGACTCACAATGGCGTGCCTGT
>sequence premixd
GCAGAATCGGCTATCTTTTGACATTCGTGCTGCAccccccccccAAGAAGGAGCTGAACATGCGCTTGTGGATTGCAATGATCATGATGGGCCTGACTGGCCTCGGCCAGGCAGCGATCAAGACCGAGCAGATCGATTACAAAAGTGCCGACGGTACAAAACTGGTGGGTTACTACGCTTACGACGACGCCGTAAAAGGCCCGCGCCCCGGTGTGCTGGTGGTTCACGAGTGGTGGGGCCTGAACGACTACGCCAAGCGCCGCGCCCGTGATCTGGCGGCACTGGGTTACAGCGCCATGGCCATCGACATGTACGGCGAAGGCAAGAACACCGAGCACCCGAAAGACGCGATGGCCTTCATGCAGGCCGCGCTCAAGGACAGCGATGCGGCCGACAAGCGCTTTGATGCCGGGCTTGAGCAATTGAAGAAACAACCGCAGACCGACCCGAAAAAGATTGCAGCGGTGGGTTACTGCTTCGGCGGCAAGATCGTGCTGGACGCGGCCCGTCGCGGCGAACCGTTGCTGGGCGTGGTCAGCTTCCACGGCGCACTGTTCACCAATAGCCCGGCCAAACCGGGCATCAAAGTGCCAATGCTGGTCGAGCATGGTGCCAAGGACAGCATGGTCACACCGGAGAACGTCGCCGCCTTCAAGAAGGAAATGGACGACGCCAAGGCAGACTATAAATTCGTCAGCATCGACGGCGCCAAACACGGCTTCACCAACCCCGACGCCGACCGCCTGAGCCACGGCGAACACGGCGGCCCGGACAT



 CLUSTAL W (1.81) Multiple Sequence Alignments



Sequence type explicitly set to Protein
Sequence format is Pearson
Sequence 1: sequence_ref         1357 aa
Sequence 2: sequence_premixa      780 aa
Sequence 3: sequence_premixb      698 aa
Sequence 4: sequence_premixc      751 aa
Sequence 5: sequence_premixd      775 aa
Start of Pairwise alignments
Aligning...


(Partial alignment)
Sequences (1:2) Aligned. Score: 69.1026
(Partial alignment)
Sequences (1:3) Aligned. Score: 29.5129
(Partial alignment)
Sequences (1:4) Aligned. Score: 56.0586
(Partial alignment)
Sequences (1:5) Aligned. Score: 29.2903
(Partial alignment)
Sequences (2:2) Aligned. Score: 57.8205
(Partial alignment)
Sequences (2:3) Aligned. Score: 29.0831
(Partial alignment)
Sequences (2:4) Aligned. Score: 30.4927
(Partial alignment)
Sequences (2:5) Aligned. Score: 25.4194
(Partial alignment)
Sequences (3:2) Aligned. Score: 29.7994
Sequences (3:3) Aligned. Score: 100
(Partial alignment)
Sequences (3:4) Aligned. Score: 25.5014
(Partial alignment)
Sequences (3:5) Aligned. Score: 31.9484
(Partial alignment)
Sequences (4:2) Aligned. Score: 43.8083
(Partial alignment)
Sequences (4:3) Aligned. Score: 27.6504
(Partial alignment)
Sequences (4:4) Aligned. Score: 70.0399
(Partial alignment)
Sequences (4:5) Aligned. Score: 25.1664
(Partial alignment)
Sequences (5:2) Aligned. Score: 24.3871
(Partial alignment)
Sequences (5:3) Aligned. Score: 32.5215
(Partial alignment)
Sequences (5:4) Aligned. Score: 23.968
(Partial alignment)
Sequences (5:5) Aligned. Score: 70.4516
Guide tree        file created:   [clustalw.dnd]
Start of Multiple Alignment
There are 4 groups
Aligning...
Group 1: Sequences:   2      Score:15609
Group 2: Sequences:   3      Score:6418
Group 3: Sequences:   2      Score:5280
Group 4: Sequences:   5      Score:3940
Alignment Score 24464
CLUSTAL-Alignment file created  [clustalw.aln]

clustalw.aln

CLUSTAL W (1.81) multiple sequence alignment


sequence_ref          AAAACACCTGCATGTCTGACCACGAGCTCTGGTCCGCGG-CCTTGTCGTAGCCGATGTCC
sequence_premixa      ------------TGTCTGACCACAAGCTCTGGTCCGCGTGCCTTGTCGTAGCCGATGTCC
sequence_premixc      ------------------------------------------------------------
sequence_premixb      ------------------------------------------------------------
sequence_premixd      ------------------------------------------------------------
                                                                                 

sequence_ref          GGGCCGCCGTGTTCGCCGTG-GCTCAGGCGGTCGGCGTCGGGGTTGGTGAAGCCGTGTTT
sequence_premixa      GGGCCGCCGTGTTCGCCGTGGTGTCAGGCGGTCGGCGTCCGGGTTGGTGAAGCCGTGTTT
sequence_premixc      ------------------------------------------------------------
sequence_premixb      ------------------------------------------------------------
sequence_premixd      ------------------------------------------------------------
                                                                                 

sequence_ref          GGCGCCGTCGATGCTGACGAATTTATAGTCTGCCTTGGCGTCGTCCATTTCCTTCTTGAA
sequence_premixa      GGCGCCGTCGATGCTGACGAATTTATAGTCTGCCTTGGCGTCATCCATTTCCTTCTTGAA
sequence_premixc      ------------------------------------------------------------
sequence_premixb      ------------------------------------------------------------
sequence_premixd      ------------------------------------------------------------
                                                                                 

sequence_ref          GGCGGCGACGTTCTCCGGTGTGACCATGCTGTCCTTGGCACCATGCTCGACCAGCATTGG
sequence_premixa      GGCGGCGACGTTCTCCGGTGTGACCATGCTGTCCTTGGCACCATGCTCGACCAACATTGG
sequence_premixc      ------------------------------------------------------------
sequence_premixb      -----------------------------------GCGCTTCATCCTCGACTACCAACA-
sequence_premixd      ----------------------------------------GCAGAATCGGCTATCTTTTG
                                                                                 

sequence_ref          CACTTTGATGCCCGGTTTGGCCGGGCTATTGGTGAACAGTGCGCCGTGGAAGCTGACCAC
sequence_premixa      CACTTTGATGCCCGGTTTGGCCGGGCTATTGGTGAACAGTGCGCCGTGCAAGCTGACCAC
sequence_premixc      ------------------------------------------------------------
sequence_premixb      -ACTTCATG----------------------------------------CAG-----CTC
sequence_premixd      ACATTCGTG----------------------------------------CTGCACCCCCC
                                                                                 

sequence_ref          GCCCAGCAACGGTTCGCCGCGACGGGCCGCGTCCAGCACGATCTTGCCGCCGAAGCAGTA
sequence_premixa      GCCCAGCAACGGTTCGCCGCGACGGGCCACGTCCAGCACGATCTTGCCGCCGAAGCAGTA
sequence_premixc      ------------------------------------------------------------
sequence_premixb      TCCCAGGCACAATCACAGCCTCAAGACAAAGATTGAAACGACATCGTCG--CCT--CAGT
sequence_premixd      CCCCAAGAAGGAGCTGAACATGCGCTTGTGGATTGCAATGATCATGATGGGCCTGACTGG
                                                                                 

sequence_ref          ACCCACCGCTGCAATCTTTTTCGGGTCGGTCTGCGGTTGTTTCTTCAATTGCTCAAGCCC
sequence_premixa      ACCCACCGCTGCAATCTTTTTCGGGTCGGTCTGCGGTTGTTTCTTCAATTGCTCAAGCCC
sequence_premixc      ------------------------------------------------------------
sequence_premixb      ACTCAACAGGCGGGCGCTGACGGGCACAGGCTGTG-------------------------
sequence_premixd      CCTCGGCCAGGCAGCGAT--CAAGACCGAGCAGAT-------------------------
                                                                                 

sequence_ref          GGCATCAAAGCGCTTGTCGGCCGCATCGCTGTCCTTGAGCGCGGCCTGCATGAAGGCCAT
sequence_premixa      GGCATCAAAGCGCTTGTCGGCCGCATCGCTGTCCTTGAGCGCGGCCTGCATGAATGCCAT
sequence_premixc      ------------------------ATCGCTGTCCTTGAGCGCGGCCTGCATGAAGGCCAT
sequence_premixb      -----------------TCACATCATAGCTGCC------------CAGCAG----GATTT
sequence_premixd      -----------------CGATTACAAAAGTGCCGACGGTACAAAACTGGTG----GGTTA
                                              *:.. ** *            *:* :     *  ::

sequence_ref          CGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCGCCGTACATGTCGATGGCCATGGCGCT
sequence_premixa      CGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCCCCGTACATGTCAATGGCCATGGGGCT
sequence_premixc      CGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCGCCGTACATGTCGATGGCCATGGCGCT
sequence_premixb      CGCGGCTGACAGGCACGCCATTGTGAGTCCCCG--TCAGACTGCCGTAAACCGGCGGAGA
sequence_premixd      CTACGCTTACGACGACGCCGTAAAAGGCCCGCGCCCCGGTGTGCTGGTGGTTCACGAGTG
                      * .  ** :*..  .* * .*  :    **        .  **  . :..     * . 

sequence_ref          GTAACCCAGTGCCGCCAGATCACGGGCGCGGCGCTTGGCGTAGTCGTTCAGGCCCCACCA
sequence_premixa      GTAACCCAATGCCGCCAGATCACAGGCGCGGCGCTTGGCGTAATCCTTCAGGCCCCACCA
sequence_premixc      GTAACCCAGTGCCGCCAGATCACGGGCGCGGCGCTTGGCGTAGTCGTTCAGGCCCCACCA
sequence_premixb      ATAAAGCGTCCCCACCGACACATTGGATCG----------------------CGCCTG--
sequence_premixd      GTGGGGCCTGAACGACTACGCCAAGCGCCG----------------------CGCCCGTG
                      .*..  *    .*..* .. *.  *   **                      * **   

sequence_ref          CTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTAGTA
sequence_premixa      CTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTACTA
sequence_premixc      CTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTAGTA
sequence_premixb      CTCATTAAGCGCATG--------CCCCCAG-CTGTTGGCGTCGTCG-------------A
sequence_premixd      ATCTGGCGGCACTGGGTTACAGCGCCATGG-CCATCGACATGTACGGCGAAGGCAAGAAC
                      .**   .. *.*  *          *  .* *  *  .*.   :**             .

sequence_ref          ACCCACCAGTT--TTGTACCGTCGGCACTTTTGTAATCGATCTGCTCGGTCTTGATCGCT
sequence_premixa      ACCCACCAGTT--TTGTACCGTCGTCACTTTTGTAATCGATCTGCTCGGTCTAGATCGCT
sequence_premixc      ACCCACCAGTT--TTGTACCGTCGGCACTTTTGTAATCGATCTGCTCGGTCTTGATCGCT
sequence_premixb      ACCTTTCACTG----GTCTTGCCGAACTCGATGCGGGCCACG-TCAAG-CCTGCCAT-CG
sequence_premixd      ACCGAGCACCCGAAAGACGCGATGGCCTTCATGCAGGCCGCGCTCAAGGACAGCGATGCG
                      *** : **       *:.  *  * ..   :** .. * .    *:.*  *:   :  *

sequence_ref          GCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCACAAG-CGCATGTTCAG
sequence_premixa      GCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCACGAAGCACATGTTCAG
sequence_premixc      GCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCACAAG-CGCATGTTCAG
sequence_premixb      CCCG--CCTG------CGCCGCCGCACTGCCACCCAG-AAAAGCCAAG-------GCCAG
sequence_premixd      GCCG--ACAAGCGCTTTGATGCCGGGCTTGAGCAATTGAAGAAACAAC-------CGCAG
                       **   .* .        . ***   *:  . *. :  ** . .*.*          ***

sequence_ref          CTCCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGATAGCCGATTCTGCCGCCTGC
sequence_premixa      CTCCTTTCTTGGGG----------------------------------------------
sequence_premixc      CTCCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGATAGCCGATTCTGCCGCCTGC
sequence_premixb      GAAAAACTTGTTGAG---------------------ATT-CAACATTTCG--ACTCCTTT
sequence_premixd      ACCGACCCGAAAAAG---------------------ATTGCAGCGGTGGGTTACTGCTTC
                        . :       ..                                             

sequence_ref          GGCGCGCACGACTGTTCAGCGCCGGTTCATCGCGTGTTCAGTCGGGGTTCAGCCCGGCGC
sequence_premixa      ------------------------------------------------------------
sequence_premixc      GGCGCGCACGACTGTTCAGCGCCGGTTCATCGCGTGTTCAGTCGGGGTTCAGCCCGGCGC
sequence_premixb      TGCG----------------------------CTCGGGGACGCTG-TCAAGGTACGGCTC
sequence_premixd      GGCGG---------------------------CAAGATCGTGCTGGACGCGGCCCGTCGC
                                                                                 

sequence_ref          GATTACTGTTG-AGCCGTACCTTGACAGCGTCCCCGAGCGCAAAAGGAGTCGAAATGTTG
sequence_premixa      ------------------------------------------------------------
sequence_premixc      GATTACTGTTG-AGCCGTACCTTGACAGCGTCCCCGAGCGCAAAAGGAGTCGAAATGTTG
sequence_premixb      AACAGTAATCG-CGCCGGGCTG----AACCCCGACTG-AACACG------CGATGAACCG
sequence_premixd      GGCG--AACCGTTGCTGGGCGTGGTCAGCTTCCACGG-CGCACTGTTCACCAATAGCCCG
                                                                                 

sequence_ref          AATCTCAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTGGCAGTGCGGCGGCGCAGGCG
sequence_premixa      ------------------------------------------------------------
sequence_premixc      AATCTCAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTGGCAGTGCGGCGGCGCAGGCG
sequence_premixb      GCGCTGAACAGTCG------------TGCGCGCCG-----------------------CA
sequence_premixd      GC-CAAACCGGGCATCAAAGTGCCAATGCTGGTCG-----------------------AG
                                                                                 

sequence_ref          GGCGATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGCAAGACCAGTGAAAGGTTCGAC
sequence_premixa      ------------------------------------------------------------
sequence_premixc      GGCGATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGCAAGACCAGTGAAAGGTTCGAC
sequence_premixb      GGCGGCAGAATCGGCTATCTTTTGACATTCGTGCTGCACCCCCCCCCCAAGAAG---GAG
sequence_premixd      CATGGTGCCAAGGACAGCATGGTCACACCGGAGAACGTCGCCGCCTTCAAGAAG---GAA
                                                                                 

sequence_ref          GACGCCAACAGCTGGGGGCATGCGCTTAATGAGCAGGCGCGATCCAATGTGTCGGTGGGG
sequence_premixa      ------------------------------------------------------------
sequence_premixc      GACGCCAACAGCTGGGGGCATGCGCTTAATGAGCAGGCGCGATCCAATGTGTCGGTGGGG
sequence_premixb      CTGAACATGCGCTTGTGGATTGCAATGATCATGATGGGCCTGACTGGCCTCGGCCAGGCA
sequence_premixd      ATGGACG-ACGCCAAGG-CAGACTATAAATTCGTCAGCATCGACGGCGCCAAACACGGCT
                                                                                 

sequence_ref          ACGCTTTATTCTCCGCCGGTTTACGGCAGTCTGACGGGGACTCACAATGGCGTGCCTGTC
sequence_premixa      ------------------------------------------------------------
sequence_premixc      ACGCTTTATTCTCCGCCGGTTTACGGCAGTCTGACGGGGACTCACAATGGCGTGCCTGT-
sequence_premixb      GCGATCAAGACCGAGCAG-------ATCGATTACAAAAGTGCCGACGGTACAAAACTGGT
sequence_premixd      TCACCAACCCCGACGCCG-------ACCGCCTGAGCCACGGCGAACACGGCGGCCCGGAC
                                                                                 

sequence_ref          AGCCGCGAAATCCTGCTGGGCAGCTATGATGTGACACAGCCTGTGCCCGTCAGCGCCCGC
sequence_premixa      ------------------------------------------------------------
sequence_premixc      ------------------------------------------------------------
sequence_premixb      GGG---------------------------------------------------------
sequence_premixd      AT----------------------------------------------------------
                                                                                 

sequence_ref          CTGTTGAGTACTGAGGCGACGATGTCGTTTCAATCTTTGTCTTGAGGCTGTGATTGTGCC
sequence_premixa      ------------------------------------------------------------
sequence_premixc      ------------------------------------------------------------
sequence_premixb      ------------------------------------------------------------
sequence_premixd      ------------------------------------------------------------
                                                                                 

sequence_ref          TGGGAGAGCTGCATGAAGTTGTTGGTAGTCGAGGATGAAGCGC
sequence_premixa      -------------------------------------------
sequence_premixc      -------------------------------------------
sequence_premixb      -------------------------------------------
sequence_premixd      -------------------------------------------
Title: Re: James, LW, and JD (and others if interested)
Post by: Ichimaru Gin :] on November 03, 2010, 09:41:22 AM
After analysis, I found b needing to be corrected for (simply Clustal W cannot recognize reverse compliment)
>/tmp/outseq.input.22191  [Unknown form], reverse complement, 698 bases, 1F97 checksum.
CCCACCAGTTTTGTACCGTCGGCACTTTTGTAATCGATCTGCTCGGTCTT
GATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCC
ACAAGCGCATGTTCAGCTCCTTCTTGGGGGGGGGGTGCAGCACGAATGTC
AAAAGATAGCCGATTCTGCCGCCTGCGGCGCGCACGACTGTTCAGCGCCG
GTTCATCGCGTGTTCAGTCGGGGTTCAGCCCGGCGCGATTACTGTTGAGC
CGTACCTTGACAGCGTCCCCGAGCGCAAAAGGAGTCGAAATGTTGAATCT
CAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTGGCAGTGCGGCGGCGC
AGGCGGGCGATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGCAAGACC
AGTGAAAGGTTCGACGACGCCAACAGCTGGGGGCATGCGCTTAATGAGCA
GGCGCGATCCAATGTGTCGGTGGGGACGCTTTATTCTCCGCCGGTTTACG
GCAGTCTGACGGGGACTCACAATGGCGTGCCTGTCAGCCGCGAAATCCTG
CTGGGCAGCTATGATGTGACACAGCCTGTGCCCGTCAGCGCCCGCCTGTT
GAGTACTGAGGCGACGATGTCGTTTCAATCTTTGTCTTGAGGCTGTGATT
GTGCCTGGGAGAGCTGCATGAAGTTGTTGGTAGTCGAGGATGAAGCGC

Corrected B Clustal W Analysis:

Raw input using FASTA
Quote
>sequence ref
AAAACACCTGCATGTCTGACCACGAGCTCTGGTCCGCGGCCTTGTCGTAGCCGATGTCCGGGCCGCCGTGTTCGCCGTGGCTCAGGCGGTCGGCGTCGGGGTTGGTGAAGCCGTGTTTGGCGCCGTCGATGCTGACGAATTTATAGTCTGCCTTGGCGTCGTCCATTTCCTTCTTGAAGGCGGCGACGTTCTCCGGTGTGACCATGCTGTCCTTGGCACCATGCTCGACCAGCATTGGCACTTTGATGCCCGGTTTGGCCGGGCTATTGGTGAACAGTGCGCCGTGGAAGCTGACCACGCCCAGCAACGGTTCGCCGCGACGGGCCGCGTCCAGCACGATCTTGCCGCCGAAGCAGTAACCCACCGCTGCAATCTTTTTCGGGTCGGTCTGCGGTTGTTTCTTCAATTGCTCAAGCCCGGCATCAAAGCGCTTGTCGGCCGCATCGCTGTCCTTGAGCGCGGCCTGCATGAAGGCCATCGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCGCCGTACATGTCGATGGCCATGGCGCTGTAACCCAGTGCCGCCAGATCACGGGCGCGGCGCTTGGCGTAGTCGTTCAGGCCCCACCACTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTAGTAACCCACCAGTTTTGTACCGTCGGCACTTTTGTAATCGATCTGCTCGGTCTTGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCACAAGCGCATGTTCAGCTCCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGATAGCCGATTCTGCCGCCTGCGGCGCGCACGACTGTTCAGCGCCGGTTCATCGCGTGTTCAGTCGGGGTTCAGCCCGGCGCGATTACTGTTGAGCCGTACCTTGACAGCGTCCCCGAGCGCAAAAGGAGTCGAAATGTTGAATCTCAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTGGCAGTGCGGCGGCGCAGGCGGGCGATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGCAAGACCAGTGAAAGGTTCGACGACGCCAACAGCTGGGGGCATGCGCTTAATGAGCAGGCGCGATCCAATGTGTCGGTGGGGACGCTTTATTCTCCGCCGGTTTACGGCAGTCTGACGGGGACTCACAATGGCGTGCCTGTCAGCCGCGAAATCCTGCTGGGCAGCTATGATGTGACACAGCCTGTGCCCGTCAGCGCCCGCCTGTTGAGTACTGAGGCGACGATGTCGTTTCAATCTTTGTCTTGAGGCTGTGATTGTGCCTGGGAGAGCTGCATGAAGTTGTTGGTAGTCGAGGATGAAGCGC
>sequence premixa
TGTCTGACCACAAGCTCTGGTCCGCGTGCCTTGTCGTAGCCGATGTCCGGGCCGCCGTGTTCGCCGTGGTGTCAGGCGGTCGGCGTCCGGGTTGGTGAAGCCGTGTTTGGCGCCGTCGATGCTGACGAATTTATAGTCTGCCTTGGCGTCATCCATTTCCTTCTTGAAGGCGGCGACGTTCTCCGGTGTGACCATGCTGTCCTTGGCACCATGCTCGACCAACATTGGCACTTTGATGCCCGGTTTGGCCGGGCTATTGGTGAACAGTGCGCCGTGCAAGCTGACCACGCCCAGCAACGGTTCGCCGCGACGGGCCACGTCCAGCACGATCTTGCCGCCGAAGCAGTAACCCACCGCTGCAATCTTTTTCGGGTCGGTCTGCGGTTGTTTCTTCAATTGCTCAAGCCCGGCATCAAAGCGCTTGTCGGCCGCATCGCTGTCCTTGAGCGCGGCCTGCATGAATGCCATCGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCCCCGTACATGTCAATGGCCATGGGGCTGTAACCCAATGCCGCCAGATCACAGGCGCGGCGCTTGGCGTAATCCTTCAGGCCCCACCACTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTACTAACCCACCAGTTTTGTACCGTCGTCACTTTTGTAATCGATCTGCTCGGTCTAGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCACGAAGCACATGTTCAGCTCCTTTCTTGGGG
>sequence premixb
CCCACCAGTTTTGTACCGTCGGCACTTTTGTAATCGATCTGCTCGGTCTTGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCACAAGCGCATGTTCAGCTCCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGATAGCCGATTCTGCCGCCTGCGGCGCGCACGACTGTTCAGCGCCGGTTCATCGCGTGTTCAGTCGGGGTTCAGCCCGGCGCGATTACTGTTGAGCCGTACCTTGACAGCGTCCCCGAGCGCAAAAGGAGTCGAAATGTTGAATCTCAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTGGCAGTGCGGCGGCGCAGGCGGGCGATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGCAAGACCAGTGAAAGGTTCGACGACGCCAACAGCTGGGGGCATGCGCTTAATGAGCAGGCGCGATCCAATGTGTCGGTGGGGACGCTTTATTCTCCGCCGGTTTACGGCAGTCTGACGGGGACTCACAATGGCGTGCCTGTCAGCCGCGAAATCCTGCTGGGCAGCTATGATGTGACACAGCCTGTGCCCGTCAGCGCCCGCCTGTTGAGTACTGAGGCGACGATGTCGTTTCAATCTTTGTCTTGAGGCTGTGATTGTGCCTGGGAGAGCTGCATGAAGTTGTTGGTAGTCGAGGATGAAGCGC
>sequence premixc
ATCGCTGTCCTTGAGCGCGGCCTGCATGAAGGCCATCGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCGCCGTACATGTCGATGGCCATGGCGCTGTAACCCAGTGCCGCCAGATCACGGGCGCGGCGCTTGGCGTAGTCGTTCAGGCCCCACCACTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTAGTAACCCACCAGTTTTGTACCGTCGGCACTTTTGTAATCGATCTGCTCGGTCTTGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCACAAGCGCATGTTCAGCTCCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGATAGCCGATTCTGCCGCCTGCGGCGCGCACGACTGTTCAGCGCCGGTTCATCGCGTGTTCAGTCGGGGTTCAGCCCGGCGCGATTACTGTTGAGCCGTACCTTGACAGCGTCCCCGAGCGCAAAAGGAGTCGAAATGTTGAATCTCAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTGGCAGTGCGGCGGCGCAGGCGGGCGATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGCAAGACCAGTGAAAGGTTCGACGACGCCAACAGCTGGGGGCATGCGCTTAATGAGCAGGCGCGATCCAATGTGTCGGTGGGGACGCTTTATTCTCCGCCGGTTTACGGCAGTCTGACGGGGACTCACAATGGCGTGCCTGT
>sequence premixd
GCAGAATCGGCTATCTTTTGACATTCGTGCTGCACCCCCCCCCCAAGAAGGAGCTGAACATGCGCTTGTGGATTGCAATGATCATGATGGGCCTGACTGGCCTCGGCCAGGCAGCGATCAAGACCGAGCAGATCGATTACAAAAGTGCCGACGGTACAAAACTGGTGGGTTACTACGCTTACGACGACGCCGTAAAAGGCCCGCGCCCCGGTGTGCTGGTGGTTCACGAGTGGTGGGGCCTGAACGACTACGCCAAGCGCCGCGCCCGTGATCTGGCGGCACTGGGTTACAGCGCCATGGCCATCGACATGTACGGCGAAGGCAAGAACACCGAGCACCCGAAAGACGCGATGGCCTTCATGCAGGCCGCGCTCAAGGACAGCGATGCGGCCGACAAGCGCTTTGATGCCGGGCTTGAGCAATTGAAGAAACAACCGCAGACCGACCCGAAAAAGATTGCAGCGGTGGGTTACTGCTTCGGCGGCAAGATCGTGCTGGACGCGGCCCGTCGCGGCGAACCGTTGCTGGGCGTGGTCAGCTTCCACGGCGCACTGTTCACCAATAGCCCGGCCAAACCGGGCATCAAAGTGCCAATGCTGGTCGAGCATGGTGCCAAGGACAGCATGGTCACACCGGAGAACGTCGCCGCCTTCAAGAAGGAAATGGACGACGCCAAGGCAGACTATAAATTCGTCAGCATCGACGGCGCCAAACACGGCTTCACCAACCCCGACGCCGACCGCCTGAGCCACGGCGAACACGGCGGCCCGGACAT

 

 CLUSTAL W (1.81) Multiple Sequence Alignments



Sequence type explicitly set to Protein
Sequence format is Pearson
Sequence 1: sequence_ref         1357 aa
Sequence 2: sequence_premixa      780 aa
Sequence 3: sequence_premixb      698 aa
Sequence 4: sequence_premixc      751 aa
Sequence 5: sequence_premixd      779 aa
Start of Pairwise alignments
Aligning...


(Partial alignment)
Sequences (1:2) Aligned. Score: 69.1026
(Partial alignment)
Sequences (1:3) Aligned. Score: 34.5272
(Partial alignment)
Sequences (1:4) Aligned. Score: 56.0586
(Partial alignment)
Sequences (1:5) Aligned. Score: 26.9576
(Partial alignment)
Sequences (2:2) Aligned. Score: 57.8205
(Partial alignment)
Sequences (2:3) Aligned. Score: 25.788
(Partial alignment)
Sequences (2:4) Aligned. Score: 30.4927
(Partial alignment)
Sequences (2:5) Aligned. Score: 25.2888
(Partial alignment)
Sequences (3:2) Aligned. Score: 25.6447
Sequences (3:3) Aligned. Score: 100
(Partial alignment)
Sequences (3:4) Aligned. Score: 75.788
(Partial alignment)
Sequences (3:5) Aligned. Score: 26.2178
(Partial alignment)
Sequences (4:2) Aligned. Score: 43.8083
(Partial alignment)
Sequences (4:3) Aligned. Score: 60.1719
(Partial alignment)
Sequences (4:4) Aligned. Score: 70.0399
(Partial alignment)
Sequences (4:5) Aligned. Score: 25.1664
(Partial alignment)
Sequences (5:2) Aligned. Score: 24.2619
(Partial alignment)
Sequences (5:3) Aligned. Score: 26.5043
(Partial alignment)
Sequences (5:4) Aligned. Score: 23.968
(Partial alignment)
Sequences (5:5) Aligned. Score: 87.163
Guide tree        file created:   [clustalw.dnd]
Start of Multiple Alignment
There are 4 groups
Aligning...
Group 1: Sequences:   2      Score:15609
Group 2: Sequences:   2      Score:10934
Group 3: Sequences:   4      Score:5203
Group 4:                     Delayed
Sequence:5     Score:4436
Alignment Score 31313
CLUSTAL-Alignment file created  [clustalw.aln]

clustalw.aln

CLUSTAL W (1.81) multiple sequence alignment


sequence_ref          AAAACACCTGCATGTCTGACCACGAGCTCTGGTCCGCGG-CCTTGTCGTAGCCGATGTCC
sequence_premixa      ------------TGTCTGACCACAAGCTCTGGTCCGCGTGCCTTGTCGTAGCCGATGTCC
sequence_premixb      ------------------------------------------------------------
sequence_premixc      ------------------------------------------------------------
sequence_premixd      ------------------------------------------------------------
                                                                                 

sequence_ref          GGGCCGCCGTGTTCGCCGTG-GCTCAGGCGGTCGGCGTCGGGGTTGGTGAAGCCGTGTTT
sequence_premixa      GGGCCGCCGTGTTCGCCGTGGTGTCAGGCGGTCGGCGTCCGGGTTGGTGAAGCCGTGTTT
sequence_premixb      ------------------------------------------------------------
sequence_premixc      ------------------------------------------------------------
sequence_premixd      ------------------------------------------------------------
                                                                                 

sequence_ref          GGCGCCGTCGATGCTGACGAATTTATAGTCTGCCTTGGCGTCGTCCATTTCCTTCTTGAA
sequence_premixa      GGCGCCGTCGATGCTGACGAATTTATAGTCTGCCTTGGCGTCATCCATTTCCTTCTTGAA
sequence_premixb      ------------------------------------------------------------
sequence_premixc      ------------------------------------------------------------
sequence_premixd      ------------------------------------------------------------
                                                                                 

sequence_ref          GGCGGCGACGTTCTCCGGTGTGACCATGCTGTCCTTGGCACCATGCTCGACCAGCATTGG
sequence_premixa      GGCGGCGACGTTCTCCGGTGTGACCATGCTGTCCTTGGCACCATGCTCGACCAACATTGG
sequence_premixb      ------------------------------------------------------------
sequence_premixc      ------------------------------------------------------------
sequence_premixd      ------------------------------------------------------------
                                                                                 

sequence_ref          CACTTTGATGCCCGGTTTGGCCGGGCTATTGGTGAACAGTGCGCCGTGGAAGCTGACCAC
sequence_premixa      CACTTTGATGCCCGGTTTGGCCGGGCTATTGGTGAACAGTGCGCCGTGCAAGCTGACCAC
sequence_premixb      ------------------------------------------------------------
sequence_premixc      ------------------------------------------------------------
sequence_premixd      ------------------------------------------------------------
                                                                                 

sequence_ref          GCCCAGCAACGGTTCGCCGCGACGGGCCGCGTCCAGCACGATCTTGCCGCCGAAGCAGTA
sequence_premixa      GCCCAGCAACGGTTCGCCGCGACGGGCCACGTCCAGCACGATCTTGCCGCCGAAGCAGTA
sequence_premixb      ------------------------------------------------------------
sequence_premixc      ------------------------------------------------------------
sequence_premixd      ------------------------------------------------------------
                                                                                 

sequence_ref          ACCCACCGCTGCAATCTTTTTCGGGTCGGTCTGCGGTTGTTTCTTCAATTGCTCAAGCCC
sequence_premixa      ACCCACCGCTGCAATCTTTTTCGGGTCGGTCTGCGGTTGTTTCTTCAATTGCTCAAGCCC
sequence_premixb      ------------------------------------------------------------
sequence_premixc      ------------------------------------------------------------
sequence_premixd      -GCAGAATCGGCTATCTTTTGACATTCG------------------TGCTGCACCCCCCC
                                                                                 

sequence_ref          GGCATCAAAGCGCTTGTCGGCCGCATCGCTGTCCTTGAGCGCGGCCTGCATGAAGGCCAT
sequence_premixa      GGCATCAAAGCGCTTGTCGGCCGCATCGCTGTCCTTGAGCGCGGCCTGCATGAATGCCAT
sequence_premixb      ------------------------------------------------------------
sequence_premixc      ------------------------ATCGCTGTCCTTGAGCGCGGCCTGCATGAAGGCCAT
sequence_premixd      CCCAAGAAGGAGCTG-------AACATGCGCTTGTGGATTGCAATGATCATGATGGGCCT
                                                                                 

sequence_ref          CGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCGCCGTACATGTCGATGGCCATGGCGCT
sequence_premixa      CGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCCCCGTACATGTCAATGGCCATGGGGCT
sequence_premixb      ------------------------------------------------------------
sequence_premixc      CGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCGCCGTACATGTCGATGGCCATGGCGCT
sequence_premixd      GACTGGCCTCGGCCAGGCAGCGATCAAG-----ACCGAGCAGATCGATTACAAAAGTGCC
                                                                                 

sequence_ref          GTAACCCAGTGCCGCCAGATCACGGGCGCGGCGCTTGGCGTAGTCGTTCAGGCCCCACCA
sequence_premixa      GTAACCCAATGCCGCCAGATCACAGGCGCGGCGCTTGGCGTAATCCTTCAGGCCCCACCA
sequence_premixb      ------------------------------------------------------------
sequence_premixc      GTAACCCAGTGCCGCCAGATCACGGGCGCGGCGCTTGGCGTAGTCGTTCAGGCCCCACCA
sequence_premixd      G---ACGGTACAAAACTGGTGGGTTACTACGCTTACGACGACGCCGTAAAAGGCCCGCGC
                                                                                 

sequence_ref          CTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTAGTA
sequence_premixa      CTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTACTA
sequence_premixb      ------------------------------------------------------------
sequence_premixc      CTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTAGTA
sequence_premixd      CCCGGTGTGCTGGTGGTTCACGAGTGGTGGGGCCTGAACGACTACGCCAAGCGC------
                                                                                 

sequence_ref          ACCCACCAGTTTTGTACCG----------TCGGCACTTTTGTAATCGATCTGCTCG----
sequence_premixa      ACCCACCAGTTTTGTACCG----------TCGTCACTTTTGTAATCGATCTGCTCG----
sequence_premixb      -CCCACCAGTTTTGTACCG----------TCGGCACTTTTGTAATCGATCTGCTCG----
sequence_premixc      ACCCACCAGTTTTGTACCG----------TCGGCACTTTTGTAATCGATCTGCTCG----
sequence_premixd      -CGCGCCCGTGATCTGGCGGCACTGGGTTACAGCGCCATGGCCATCGACATGTACGGCGA
                       * *.**.** :* *. **          :*. *.* :* * .***** .** :**   

sequence_ref          -GTCTTGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCA---
sequence_premixa      -GTCTAGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCA---
sequence_premixb      -GTCTTGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCA---
sequence_premixc      -GTCTTGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCA---
sequence_premixd      AGGCAAGAACACCGAGCACCCGAAAGACGCGATGGCCTTCATGCAGGCCGCGCTCAAGGA
                       * *::**:*.* *.  . ****.. ..*  * * **:*****.: .  **..**.*   

sequence_ref          ---CAAG-CGCATGTTCAGCTCCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGAT
sequence_premixa      ---CGAAGCACATGTTCAGCTCCTTTCTTGGGG---------------------------
sequence_premixb      ---CAAG-CGCATGTTCAGCTCCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGAT
sequence_premixc      ---CAAG-CGCATGTTCAGCTCCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGAT
sequence_premixd      CAGCGATGCGGCCGACAAGCGCTTTGATGCCGGGCTTGAGCAATTGAAGAAACAACCGCA
                         *.*  *. . *: .*** * **  *   **                           

sequence_ref          AGCCGATTCTGCCGCCTGCGGCGCGCACGACTGTTCAGCGCCGGTTCATCG-CGTGTTCA
sequence_premixa      ------------------------------------------------------------
sequence_premixb      AGCCGATTCTGCCGCCTGCGGCGCGCACGACTGTTCAGCGCCGGTTCATCG-CGTGTTCA
sequence_premixc      AGCCGATTCTGCCGCCTGCGGCGCGCACGACTGTTCAGCGCCGGTTCATCG-CGTGTTCA
sequence_premixd      GACCGACCCG-------AAAAAGATTGCAGCGGTGGGTTACTGCTTCGGCGGCAAGATCG
                                                                                 

sequence_ref          GTCGGGGTTCAGCCCGGCGCG-ATTACTGTTGAGCCGTACCTTGACAGCGTCCCCGAGCG
sequence_premixa      ------------------------------------------------------------
sequence_premixb      GTCGGGGTTCAGCCCGGCGCG-ATTACTGTTGAGCCGTACCTTGACAGCGTCCCCGAGCG
sequence_premixc      GTCGGGGTTCAGCCCGGCGCG-ATTACTGTTGAGCCGTACCTTGACAGCGTCCCCGAGCG
sequence_premixd      TGCTGGACGCGGCCCGTCGCGGCGAACCGTT--GCTGGGCGTGGTCAGCTTCCACGG-CG
                                                                                 

sequence_ref          CAAAAGGAGTCGAAATGTTGAATCTCAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTG
sequence_premixa      ------------------------------------------------------------
sequence_premixb      CAAAAGGAGTCGAAATGTTGAATCTCAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTG
sequence_premixc      CAAAAGGAGTCGAAATGTTGAATCTCAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTG
sequence_premixd      CACTG----------------TTCACCAATAGCCCGGCCAAACCGGG---CATCAAAGTG
                                                                                 

sequence_ref          GCAGTGCGG-CGGCGCAGGCGGGCGATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGC
sequence_premixa      ------------------------------------------------------------
sequence_premixb      GCAGTGCGG-CGGCGCAGGCGGGCGATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGC
sequence_premixc      GCAGTGCGG-CGGCGCAGGCGGGCGATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGC
sequence_premixd      CCAATGCTGGTCGAGCATGGTGCCAAGGACAGCATGGTCACACCGGAGAACGTCGCCGCC
                                                                                 

sequence_ref          AAGACCAGTGAAAGGTTCGACGACGCCAACAGCTGGGGGCATGCGCTTAATGAGCAGGCG
sequence_premixa      ------------------------------------------------------------
sequence_premixb      AAGACCAGTGAAAGGTTCGACGACGCCAACAGCTGGGGGCATGCGCTTAATGAGCAGGCG
sequence_premixc      AAGACCAGTGAAAGGTTCGACGACGCCAACAGCTGGGGGCATGCGCTTAATGAGCAGGCG
sequence_premixd      TTCAAGAAGGAAATG---GACGACGCCAAGG--------CAGACTATAAATTCGTCAGC-
                                                                                 

sequence_ref          CGATCCAATGTGTCGGTGGGGACGCTTTATTCTCCGCCGGTTTACGGCAGTCTGACGGGG
sequence_premixa      ------------------------------------------------------------
sequence_premixb      CGATCCAATGTGTCGGTGGGGACGCTTTATTCTCCGCCGGTTTACGGCAGTCTGACGGGG
sequence_premixc      CGATCCAATGTGTCGGTGGGGACGCTTTATTCTCCGCCGGTTTACGGCAGTCTGACGGGG
sequence_premixd      --ATCGACGGCGCCAAACACGGCTTCACCAACCCCGACG----CCGACCGCCTGAG----
                                                                                 

sequence_ref          ACTCACAATGGCGTGCCTGTCAGCCGCGAAATCCTGCTGGGCAGCTATGATGTGACACAG
sequence_premixa      ------------------------------------------------------------
sequence_premixb      ACTCACAATGGCGTGCCTGTCAGCCGCGAAATCCTGCTGGGCAGCTATGATGTGACACAG
sequence_premixc      ACTCACAATGGCGTGCCTGT----------------------------------------
sequence_premixd      -----CCACGGCGAACACGGCGGCCCGGACATQUTE------------------------
                                                                                 

sequence_ref          CCTGTGCCCGTCAGCGCCCGCCTGTTGAGTACTGAGGCGACGATGTCGTTTCAATCTTTG
sequence_premixa      ------------------------------------------------------------
sequence_premixb      CCTGTGCCCGTCAGCGCCCGCCTGTTGAGTACTGAGGCGACGATGTCGTTTCAATCTTTG
sequence_premixc      ------------------------------------------------------------
sequence_premixd      ------------------------------------------------------------
                                                                                 

sequence_ref          TCTTGAGGCTGTGATTGTGCCTGGGAGAGCTGCATGAAGTTGTTGGTAGTCGAGGATGAA
sequence_premixa      ------------------------------------------------------------
sequence_premixb      TCTTGAGGCTGTGATTGTGCCTGGGAGAGCTGCATGAAGTTGTTGGTAGTCGAGGATGAA
sequence_premixc      ------------------------------------------------------------
sequence_premixd      ------------------------------------------------------------
                                                                                 

sequence_ref          GCGC
sequence_premixa      ----
sequence_premixb      GCGC
sequence_premixc      ----
sequence_premixd      ----
                         

clustalw.dnd

(
(
sequence_ref:0.11477,
sequence_premixa:0.19420)
:0.14360,
(
sequence_premixb:0.24242,
sequence_premixc:0.15586)
:0.10268,
sequence_premixd:0.44582);
Title: Re: James, LW, and JD (and others if interested)
Post by: Ichimaru Gin :] on November 03, 2010, 09:51:35 AM
After analysis, I found d needing to be corrected for (again because Clustal W cannot recognize reverse compliment)
>/tmp/outseq.input.22286  [Unknown form], reverse complement, 775 bases, 20AB checksum.
ATGTCCGGGCCGCCGTGTTCGCCGTGGCTCAGGCGGTCGGCGTCGGGGTT
GGTGAAGCCGTGTTTGGCGCCGTCGATGCTGACGAATTTATAGTCTGCCT
TGGCGTCGTCCATTTCCTTCTTGAAGGCGGCGACGTTCTCCGGTGTGACC
ATGCTGTCCTTGGCACCATGCTCGACCAGCATTGGCACTTTGATGCCCGG
TTTGGCCGGGCTATTGGTGAACAGTGCGCCGTGGAAGCTGACCACGCCCA
GCAACGGTTCGCCGCGACGGGCCGCGTCCAGCACGATCTTGCCGCCGAAG
CAGTAACCCACCGCTGCAATCTTTTTCGGGTCGGTCTGCGGTTGTTTCTT
CAATTGCTCAAGCCCGGCATCAAAGCGCTTGTCGGCCGCATCGCTGTCCT
TGAGCGCGGCCTGCATGAAGGCCATCGCGTCTTTCGGGTGCTCGGTGTTC
TTGCCTTCGCCGTACATGTCGATGGCCATGGCGCTGTAACCCAGTGCCGC
CAGATCACGGGCGCGGCGCTTGGCGTAGTCGTTCAGGCCCCACCACTCGT
GAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCG
TAGTAACCCACCAGTTTTGTACCGTCGGCACTTTTGTAATCGATCTGCTC
GGTCTTGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTG
CAATCCACAAGCGCATGTTCAGCTCCTTCTTGGGGGGGGGGTGCAGCACG
AATGTCAAAAGATAGCCGATTCTGC

Corrected B and D Clustal W Analysis:

Raw input using FASTA

Quote
>sequence ref
AAAACACCTGCATGTCTGACCACGAGCTCTGGTCCGCGGCCTTGTCGTAGCCGATGTCCGGGCCGCCGTGTTCGCCGTGGCTCAGGCGGTCGGCGTCGGGGTTGGTGAAGCCGTGTTTGGCGCCGTCGATGCTGACGAATTTATAGTCTGCCTTGGCGTCGTCCATTTCCTTCTTGAAGGCGGCGACGTTCTCCGGTGTGACCATGCTGTCCTTGGCACCATGCTCGACCAGCATTGGCACTTTGATGCCCGGTTTGGCCGGGCTATTGGTGAACAGTGCGCCGTGGAAGCTGACCACGCCCAGCAACGGTTCGCCGCGACGGGCCGCGTCCAGCACGATCTTGCCGCCGAAGCAGTAACCCACCGCTGCAATCTTTTTCGGGTCGGTCTGCGGTTGTTTCTTCAATTGCTCAAGCCCGGCATCAAAGCGCTTGTCGGCCGCATCGCTGTCCTTGAGCGCGGCCTGCATGAAGGCCATCGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCGCCGTACATGTCGATGGCCATGGCGCTGTAACCCAGTGCCGCCAGATCACGGGCGCGGCGCTTGGCGTAGTCGTTCAGGCCCCACCACTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTAGTAACCCACCAGTTTTGTACCGTCGGCACTTTTGTAATCGATCTGCTCGGTCTTGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCACAAGCGCATGTTCAGCTCCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGATAGCCGATTCTGCCGCCTGCGGCGCGCACGACTGTTCAGCGCCGGTTCATCGCGTGTTCAGTCGGGGTTCAGCCCGGCGCGATTACTGTTGAGCCGTACCTTGACAGCGTCCCCGAGCGCAAAAGGAGTCGAAATGTTGAATCTCAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTGGCAGTGCGGCGGCGCAGGCGGGCGATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGCAAGACCAGTGAAAGGTTCGACGACGCCAACAGCTGGGGGCATGCGCTTAATGAGCAGGCGCGATCCAATGTGTCGGTGGGGACGCTTTATTCTCCGCCGGTTTACGGCAGTCTGACGGGGACTCACAATGGCGTGCCTGTCAGCCGCGAAATCCTGCTGGGCAGCTATGATGTGACACAGCCTGTGCCCGTCAGCGCCCGCCTGTTGAGTACTGAGGCGACGATGTCGTTTCAATCTTTGTCTTGAGGCTGTGATTGTGCCTGGGAGAGCTGCATGAAGTTGTTGGTAGTCGAGGATGAAGCGC
>sequence premixa
TGTCTGACCACAAGCTCTGGTCCGCGTGCCTTGTCGTAGCCGATGTCCGGGCCGCCGTGTTCGCCGTGGTGTCAGGCGGTCGGCGTCCGGGTTGGTGAAGCCGTGTTTGGCGCCGTCGATGCTGACGAATTTATAGTCTGCCTTGGCGTCATCCATTTCCTTCTTGAAGGCGGCGACGTTCTCCGGTGTGACCATGCTGTCCTTGGCACCATGCTCGACCAACATTGGCACTTTGATGCCCGGTTTGGCCGGGCTATTGGTGAACAGTGCGCCGTGCAAGCTGACCACGCCCAGCAACGGTTCGCCGCGACGGGCCACGTCCAGCACGATCTTGCCGCCGAAGCAGTAACCCACCGCTGCAATCTTTTTCGGGTCGGTCTGCGGTTGTTTCTTCAATTGCTCAAGCCCGGCATCAAAGCGCTTGTCGGCCGCATCGCTGTCCTTGAGCGCGGCCTGCATGAATGCCATCGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCCCCGTACATGTCAATGGCCATGGGGCTGTAACCCAATGCCGCCAGATCACAGGCGCGGCGCTTGGCGTAATCCTTCAGGCCCCACCACTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTACTAACCCACCAGTTTTGTACCGTCGTCACTTTTGTAATCGATCTGCTCGGTCTAGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCACGAAGCACATGTTCAGCTCCTTTCTTGGGG
>sequence premixb
CCCACCAGTTTTGTACCGTCGGCACTTTTGTAATCGATCTGCTCGGTCTTGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCACAAGCGCATGTTCAGCTCCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGATAGCCGATTCTGCCGCCTGCGGCGCGCACGACTGTTCAGCGCCGGTTCATCGCGTGTTCAGTCGGGGTTCAGCCCGGCGCGATTACTGTTGAGCCGTACCTTGACAGCGTCCCCGAGCGCAAAAGGAGTCGAAATGTTGAATCTCAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTGGCAGTGCGGCGGCGCAGGCGGGCGATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGCAAGACCAGTGAAAGGTTCGACGACGCCAACAGCTGGGGGCATGCGCTTAATGAGCAGGCGCGATCCAATGTGTCGGTGGGGACGCTTTATTCTCCGCCGGTTTACGGCAGTCTGACGGGGACTCACAATGGCGTGCCTGTCAGCCGCGAAATCCTGCTGGGCAGCTATGATGTGACACAGCCTGTGCCCGTCAGCGCCCGCCTGTTGAGTACTGAGGCGACGATGTCGTTTCAATCTTTGTCTTGAGGCTGTGATTGTGCCTGGGAGAGCTGCATGAAGTTGTTGGTAGTCGAGGATGAAGCGC
>sequence premixc
ATCGCTGTCCTTGAGCGCGGCCTGCATGAAGGCCATCGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCGCCGTACATGTCGATGGCCATGGCGCTGTAACCCAGTGCCGCCAGATCACGGGCGCGGCGCTTGGCGTAGTCGTTCAGGCCCCACCACTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTAGTAACCCACCAGTTTTGTACCGTCGGCACTTTTGTAATCGATCTGCTCGGTCTTGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCACAAGCGCATGTTCAGCTCCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGATAGCCGATTCTGCCGCCTGCGGCGCGCACGACTGTTCAGCGCCGGTTCATCGCGTGTTCAGTCGGGGTTCAGCCCGGCGCGATTACTGTTGAGCCGTACCTTGACAGCGTCCCCGAGCGCAAAAGGAGTCGAAATGTTGAATCTCAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTGGCAGTGCGGCGGCGCAGGCGGGCGATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGCAAGACCAGTGAAAGGTTCGACGACGCCAACAGCTGGGGGCATGCGCTTAATGAGCAGGCGCGATCCAATGTGTCGGTGGGGACGCTTTATTCTCCGCCGGTTTACGGCAGTCTGACGGGGACTCACAATGGCGTGCCTGT
>sequence premixd
ATGTCCGGGCCGCCGTGTTCGCCGTGGCTCAGGCGGTCGGCGTCGGGGTTGGTGAAGCCGTGTTTGGCGCCGTCGATGCTGACGAATTTATAGTCTGCCTTGGCGTCGTCCATTTCCTTCTTGAAGGCGGCGACGTTCTCCGGTGTGACCATGCTGTCCTTGGCACCATGCTCGACCAGCATTGGCACTTTGATGCCCGGTTTGGCCGGGCTATTGGTGAACAGTGCGCCGTGGAAGCTGACCACGCCCAGCAACGGTTCGCCGCGACGGGCCGCGTCCAGCACGATCTTGCCGCCGAAGCAGTAACCCACCGCTGCAATCTTTTTCGGGTCGGTCTGCGGTTGTTTCTTCAATTGCTCAAGCCCGGCATCAAAGCGCTTGTCGGCCGCATCGCTGTCCTTGAGCGCGGCCTGCATGAAGGCCATCGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCGCCGTACATGTCGATGGCCATGGCGCTGTAACCCAGTGCCGCCAGATCACGGGCGCGGCGCTTGGCGTAGTCGTTCAGGCCCCACCACTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTAGTAACCCACCAGTTTTGTACCGTCGGCACTTTTGTAATCGATCTGCTCGGTCTTGATCGCTGCCTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCACAAGCGCATGTTCAGCTCCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGATAGCCGATTCTGC



 

 C CLUSTAL W (1.81) Multiple Sequence Alignments



Sequence type explicitly set to DNA
Sequence format is Pearson
Sequence 1: sequence_ref         1357 bp
Sequence 2: sequence_premixa      780 bp
Sequence 3: sequence_premixb      698 bp
Sequence 4: sequence_premixc      751 bp
Sequence 5: sequence_premixd      779 bp
Start of Pairwise alignments
Aligning...


Sequences (1:2) Aligned. Score: 30.7692
Sequences (1:3) Aligned. Score: 32.0917
Sequences (1:4) Aligned. Score: 33.1558
Sequences (1:5) Aligned. Score: 33.1194
Sequences (2:2) Aligned. Score: 35.8974
Sequences (2:3) Aligned. Score: 6.01719
Sequences (2:4) Aligned. Score: 14.6471
Sequences (2:5) Aligned. Score: 30.0385
Sequences (3:2) Aligned. Score: 6.01719
Sequences (3:3) Aligned. Score: 32.0917
Sequences (3:4) Aligned. Score: 25.9312
Sequences (3:5) Aligned. Score: 8.73926
Sequences (4:2) Aligned. Score: 14.6471
Sequences (4:3) Aligned. Score: 25.9312
Sequences (4:4) Aligned. Score: 33.1558
Sequences (4:5) Aligned. Score: 17.1771
Sequences (5:2) Aligned. Score: 30.0385
Sequences (5:3) Aligned. Score: 8.73926
Sequences (5:4) Aligned. Score: 17.1771
Sequences (5:5) Aligned. Score: 33.1194
Guide tree        file created:   [clustalw.dnd]
Start of Multiple Alignment
There are 4 groups
Aligning...
Group 1:                     Delayed
Group 2: Sequences:   2      Score:14269
Group 3:                     Delayed
Group 4: Sequences:   3      Score:10148
Sequence:2     Score:12248
Sequence:3     Score:8974
Alignment Score 39754
CLUSTAL-Alignment file created  [clustalw.aln]
Title: Re: James, LW, and JD (and others if interested)
Post by: Ichimaru Gin :] on November 03, 2010, 11:30:10 AM
CLUSTAL W (1.81) multiple sequence alignment


sequence_premixc      ------------------------------------------------------------
sequence_ref          AAAACACCTGCATGTCTGACCACGAGCTCTGGTCCGCG-GCCTTGTCGTAGCCGATGTCC
sequence_premixd      ------------------------------------------------------ATGTCC
sequence_premixa      ------------TGTCTGACCACAAGCTCTGGTCCGCGTGCCTTGTCGTAGCCGATGTCC
sequence_premixb      ------------------------------------------------------------
                                                                                 

sequence_premixc      ------------------------------------------------------------
sequence_ref          GGGCCGCCGTGTTCGCCGTGGC-TCAGGCGGTCGGCGTCGGGGTTGGTGAAGCCGTGTTT
sequence_premixd      GGGCCGCCGTGTTCGCCGTGGC-TCAGGCGGTCGGCGTCGGGGTTGGTGAAGCCGTGTTT
sequence_premixa      GGGCCGCCGTGTTCGCCGTGGTGTCAGGCGGTCGGCGTCCGGGTTGGTGAAGCCGTGTTT
sequence_premixb      ------------------------------------------------------------
                                                                                 

sequence_premixc      ------------------------------------------------------------
sequence_ref          GGCGCCGTCGATGCTGACGAATTTATAGTCTGCCTTGGCGTCGTCCATTTCCTTCTTGAA
sequence_premixd      GGCGCCGTCGATGCTGACGAATTTATAGTCTGCCTTGGCGTCGTCCATTTCCTTCTTGAA
sequence_premixa      GGCGCCGTCGATGCTGACGAATTTATAGTCTGCCTTGGCGTCATCCATTTCCTTCTTGAA
sequence_premixb      ------------------------------------------------------------
                                                                                 

sequence_premixc      ------------------------------------------------------------
sequence_ref          GGCGGCGACGTTCTCCGGTGTGACCATGCTGTCCTTGGCACCATGCTCGACCAGCATTGG
sequence_premixd      GGCGGCGACGTTCTCCGGTGTGACCATGCTGTCCTTGGCACCATGCTCGACCAGCATTGG
sequence_premixa      GGCGGCGACGTTCTCCGGTGTGACCATGCTGTCCTTGGCACCATGCTCGACCAACATTGG
sequence_premixb      ------------------------------------------------------------
                                                                                 

sequence_premixc      ------------------------------------------------------------
sequence_ref          CACTTTGATGCCCGGTTTGGCCGGGCTATTGGTGAACAGTGCGCCGTGGAAGCTGACCAC
sequence_premixd      CACTTTGATGCCCGGTTTGGCCGGGCTATTGGTGAACAGTGCGCCGTGGAAGCTGACCAC
sequence_premixa      CACTTTGATGCCCGGTTTGGCCGGGCTATTGGTGAACAGTGCGCCGTGCAAGCTGACCAC
sequence_premixb      ------------------------------------------------------------
                                                                                 

sequence_premixc      ------------------------------------------------------------
sequence_ref          GCCCAGCAACGGTTCGCCGCGACGGGCCGCGTCCAGCACGATCTTGCCGCCGAAGCAGTA
sequence_premixd      GCCCAGCAACGGTTCGCCGCGACGGGCCGCGTCCAGCACGATCTTGCCGCCGAAGCAGTA
sequence_premixa      GCCCAGCAACGGTTCGCCGCGACGGGCCACGTCCAGCACGATCTTGCCGCCGAAGCAGTA
sequence_premixb      ------------------------------------------------------------
                                                                                 

sequence_premixc      ------------------------------------------------------------
sequence_ref          ACCCACCGCTGCAATCTTTTTCGGGTCGGTCTGCGGTTGTTTCTTCAATTGCTCAAGCCC
sequence_premixd      ACCCACCGCTGCAATCTTTTTCGGGTCGGTCTGCGGTTGTTTCTTCAATTGCTCAAGCCC
sequence_premixa      ACCCACCGCTGCAATCTTTTTCGGGTCGGTCTGCGGTTGTTTCTTCAATTGCTCAAGCCC
sequence_premixb      ------------------------------------------------------------
                                                                                 

sequence_premixc      ------------------------ATCGCTGTCCTTGAGCGCGGCCTGCATGAAGGCCAT
sequence_ref          GGCATCAAAGCGCTTGTCGGCCGCATCGCTGTCCTTGAGCGCGGCCTGCATGAAGGCCAT
sequence_premixd      GGCATCAAAGCGCTTGTCGGCCGCATCGCTGTCCTTGAGCGCGGCCTGCATGAAGGCCAT
sequence_premixa      GGCATCAAAGCGCTTGTCGGCCGCATCGCTGTCCTTGAGCGCGGCCTGCATGAATGCCAT
sequence_premixb      ------------------------------------------------------------
                                                                                 

sequence_premixc      CGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCGCCGTACATGTCGATGGCCATGGCGCT
sequence_ref          CGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCGCCGTACATGTCGATGGCCATGGCGCT
sequence_premixd      CGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCGCCGTACATGTCGATGGCCATGGCGCT
sequence_premixa      CGCGTCTTTCGGGTGCTCGGTGTTCTTGCCTTCCCCGTACATGTCAATGGCCATGGGGCT
sequence_premixb      ------------------------------------------------------------
                                                                                 

sequence_premixc      GTAACCCAGTGCCGCCAGATCACGGGCGCGGCGCTTGGCGTAGTCGTTCAGGCCCCACCA
sequence_ref          GTAACCCAGTGCCGCCAGATCACGGGCGCGGCGCTTGGCGTAGTCGTTCAGGCCCCACCA
sequence_premixd      GTAACCCAGTGCCGCCAGATCACGGGCGCGGCGCTTGGCGTAGTCGTTCAGGCCCCACCA
sequence_premixa      GTAACCCAATGCCGCCAGATCACAGGCGCGGCGCTTGGCGTAATCCTTCAGGCCCCACCA
sequence_premixb      ------------------------------------------------------------
                                                                                 

sequence_premixc      CTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTAGTA
sequence_ref          CTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTAGTA
sequence_premixd      CTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTAGTA
sequence_premixa      CTCGTGAACCACCAGCACACCGGGGCGCGGGCCTTTTACGGCGTCGTCGTAAGCGTACTA
sequence_premixb      ------------------------------------------------------------
                                                                                 

sequence_premixc      ACCCACCAGTTTTGTACCGTCGGCACTTTTGTAATCGATCTGCTCGGTCTTGATCGCTGC
sequence_ref          ACCCACCAGTTTTGTACCGTCGGCACTTTTGTAATCGATCTGCTCGGTCTTGATCGCTGC
sequence_premixd      ACCCACCAGTTTTGTACCGTCGGCACTTTTGTAATCGATCTGCTCGGTCTTGATCGCTGC
sequence_premixa      ACCCACCAGTTTTGTACCGTCGTCACTTTTGTAATCGATCTGCTCGGTCTAGATCGCTGC
sequence_premixb      -CCCACCAGTTTTGTACCGTCGGCACTTTTGTAATCGATCTGCTCGGTCTTGATCGCTGC
                       ********************* *************************** *********

sequence_premixc      CTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCAC-AAGCGCATGTTCAGCT
sequence_ref          CTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCAC-AAGCGCATGTTCAGCT
sequence_premixd      CTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCAC-AAGCGCATGTTCAGCT
sequence_premixa      CTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCACGAAGCACATGTTCAGCT
sequence_premixb      CTGGCCGAGGCCAGTCAGGCCCATCATGATCATTGCAATCCAC-AAGCGCATGTTCAGCT
                      ******************************************* **** ***********

sequence_premixc      CCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGATAGCCGATTCTGCCGCCTGCGG
sequence_ref          CCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGATAGCCGATTCTGCCGCCTGCGG
sequence_premixd      CCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGATAGCCGATTCTGCQUTE-----
sequence_premixa      CCTTTCTTGGGG------------------------------------------------
sequence_premixb      CCTTCTTGGGGGGGGGGTGCAGCACGAATGTCAAAAGATAGCCGATTCTGCCGCCTGCGG
                      ****  * ****                                               

sequence_premixc      CGCGCACGACTGTTCAGCGCCGGTTCATCGCGTGTTCAGTCGGGGTTCAGCCCGGCGCGA
sequence_ref          CGCGCACGACTGTTCAGCGCCGGTTCATCGCGTGTTCAGTCGGGGTTCAGCCCGGCGCGA
sequence_premixd      ------------------------------------------------------------
sequence_premixa      ------------------------------------------------------------
sequence_premixb      CGCGCACGACTGTTCAGCGCCGGTTCATCGCGTGTTCAGTCGGGGTTCAGCCCGGCGCGA
                                                                                 

sequence_premixc      TTACTGTTGAGCCGTACCTTGACAGCGTCCCCGAGCGCAAAAGGAGTCGAAATGTTGAAT
sequence_ref          TTACTGTTGAGCCGTACCTTGACAGCGTCCCCGAGCGCAAAAGGAGTCGAAATGTTGAAT
sequence_premixd      ------------------------------------------------------------
sequence_premixa      ------------------------------------------------------------
sequence_premixb      TTACTGTTGAGCCGTACCTTGACAGCGTCCCCGAGCGCAAAAGGAGTCGAAATGTTGAAT
                                                                                 

sequence_premixc      CTCAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTGGCAGTGCGGCGGCGCAGGCGGGC
sequence_ref          CTCAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTGGCAGTGCGGCGGCGCAGGCGGGC
sequence_premixd      ------------------------------------------------------------
sequence_premixa      ------------------------------------------------------------
sequence_premixb      CTCAACAAGTTTTTCCTGGCCTTGGCTTTTCTGGGTGGCAGTGCGGCGGCGCAGGCGGGC
                                                                                 

sequence_premixc      GATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGCAAGACCAGTGAAAGGTTCGACGAC
sequence_ref          GATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGCAAGACCAGTGAAAGGTTCGACGAC
sequence_premixd      ------------------------------------------------------------
sequence_premixa      ------------------------------------------------------------
sequence_premixb      GATGGCAGGCTTGACGTGGCCCGCATCGAGTTCGGCAAGACCAGTGAAAGGTTCGACGAC
                                                                                 

sequence_premixc      GCCAACAGCTGGGGGCATGCGCTTAATGAGCAGGCGCGATCCAATGTGTCGGTGGGGACG
sequence_ref          GCCAACAGCTGGGGGCATGCGCTTAATGAGCAGGCGCGATCCAATGTGTCGGTGGGGACG
sequence_premixd      ------------------------------------------------------------
sequence_premixa      ------------------------------------------------------------
sequence_premixb      GCCAACAGCTGGGGGCATGCGCTTAATGAGCAGGCGCGATCCAATGTGTCGGTGGGGACG
                                                                                 

sequence_premixc      CTTTATTCTCCGCCGGTTTACGGCAGTCTGACGGGGACTCACAATGGCGTGCCTGT----
sequence_ref          CTTTATTCTCCGCCGGTTTACGGCAGTCTGACGGGGACTCACAATGGCGTGCCTGTCAGC
sequence_premixd      ------------------------------------------------------------
sequence_premixa      ------------------------------------------------------------
sequence_premixb      CTTTATTCTCCGCCGGTTTACGGCAGTCTGACGGGGACTCACAATGGCGTGCCTGTCAGC
                                                                                 

sequence_premixc      ------------------------------------------------------------
sequence_ref          CGCGAAATCCTGCTGGGCAGCTATGATGTGACACAGCCTGTGCCCGTCAGCGCCCGCCTG
sequence_premixd      ------------------------------------------------------------
sequence_premixa      ------------------------------------------------------------
sequence_premixb      CGCGAAATCCTGCTGGGCAGCTATGATGTGACACAGCCTGTGCCCGTCAGCGCCCGCCTG
                                                                                 

sequence_premixc      ------------------------------------------------------------
sequence_ref          TTGAGTACTGAGGCGACGATGTCGTTTCAATCTTTGTCTTGAGGCTGTGATTGTGCCTGG
sequence_premixd      ------------------------------------------------------------
sequence_premixa      ------------------------------------------------------------
sequence_premixb      TTGAGTACTGAGGCGACGATGTCGTTTCAATCTTTGTCTTGAGGCTGTGATTGTGCCTGG
                                                                                 

sequence_premixc      ----------------------------------------
sequence_ref          GAGAGCTGCATGAAGTTGTTGGTAGTCGAGGATGAAGCGC
sequence_premixd      ----------------------------------------
sequence_premixa      ----------------------------------------
sequence_premixb      GAGAGCTGCATGAAGTTGTTGGTAGTCGAGGATGAAGCGC


Results show between Blast analysis, FinchTV, and ClustalW (FASTA) analysis that correct sequence were converted from reverse comlpiments ( B and D). Overlap shows correct matching of sequencing [the stars].
Title: Re: James, LW, and JD (and others if interested)
Post by: Ichimaru Gin :] on November 05, 2010, 05:33:26 PM
Round Earthers no longer have anywhere to hide. Especially considering the pure amount of data and the fact that FinchTV is downloadable for free to review findings. Not only that, but complete input, style (FASTA), and reference sequence was given. Blast tests are also available free online.
Title: Re: James, LW, and JD (and others if interested)
Post by: John Davis on November 06, 2010, 08:10:20 AM
I'll have to look this over when I have time, but I do remember reading a book on bioinformation systems which may prove useful to processing some of this data to other ends.

That said, it was a long time ago and who knows if I still have it.  Either way, can't read to dig into this.