Experiment regarding the biological effects of moonlight

  • 15 Replies
  • 38284 Views
*

Ichimaru Gin :]

  • Undefeated FEer
  • Planar Moderator
  • 8880
  • +3/-3
  • Semper vigilans
Experiment regarding the biological effects of moonlight
« on: November 08, 2009, 04:25:42 PM »
I will provide my own evidence of the interfering properties of moonlight but first, regarding studies with plants:
Quote
Threshold values of photoperiodic time-measurements correspond approximately to moonlight intensities. Experiments with Glycine and Euglena reveal that this is also the threshold value for synchronization of the circadian cycle. Saturation of this reaction is reached with 10 lx in 12:12 hr light-dark cycles. Thus, moonlight might disturb time measurement. In Glycine, Arachis, and Trifolium the intensity of the light coming from the moon to the upper surface of the leaf is reduced by circadian leaf movement to values between 5 and 20 per cent (or even less than 5 per cent) of full-moon light intensity. Such a reduction eliminates the disturbing effects of moonlight. This finding indicates that leaf movements have an adaptive value of the kind that Darwin sought to identify. It also indicates that the behavior of the upper leaf epidermis as a ``sense organ for light'' has an adaptive value. In the short-day plants Perilla ocymoides and Chenopodium amaranticolor, a specific photoperiodic phenomenon was found that counteracts the disturbing effect of moonlight. Here light intensities similar to those of moonlight, introduced during the night, promote flowering instead of inhibiting it.
Many such experiments have been undertaken the study of plants, and found moonlight to be harmful to plant species. Those of which showed the least amount of harm where taken under scrutiny and found to have natural defenses developed overtime to counteract this behavior of moonlight. Moonlight that has been shown to be of different character than that of the sun. Under close observation was the pairing of ribulose 1,5 phosphate after the initial actions of photosystem I with an avoidance to RuBP.

Rattlesnakes and other animals harmed by moonlight

Quote
This study investigated the effect of moonlight on the nocturnal activity patterns of prairie rattlesnakes (Crotalus viridis viridis). The effect of stimulated moonlight on six adults and eight juvenile prairie rattlesnakes was tested under laboratory conditions in which temperature, feeding frequency, and photoperiod were controlled. The snakes were maintained and tested under a summer photoperiod of 14L: 10D h cycle. The activity of each snake was measured using an index of tracking in the sand floor of a test chamber under new, half, three-quarters, and full moon light (0.06, 0.35, 1.00, and 2.10 lux, respectively). Adult snake activity was significantly greater in new moonlight (starlight only) when compared to activity in three-quarter and full moonlight. The adults also significantly increased activity in open areas in dim moonlight.
Upon further review of the experiment, the cells within the rattlesnakes were found to have damage in such a way that proteins geared towards transcription were acutely damaged an in such a manner created a causation of incorrect codon pairing.  Processing in which 5? end methylated cap was needed was found to be unfinished and unable to leave the nucleus of the animal cells. AAUUAAA nevertheless was attached at the expense of the 3? tail consisting of 100s of As courtesy of Polymerase A. So as in effect, later departure of the protein was possible, however the resulting splicing of introns would be shown incorrect in the following way:
Quote
It is well known that methionine is the trigger start codon for eukaryotes. However, the traditional strand of mRNA was absent of the usual Adenine sequences needed for an initial breakup of nucleotides.
As seen: A Ala Lys Glu Trp Asn Asn Ser Leu Lys Thr Lys Leu
mRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUG  
As a result, the anticodons were eventually found insubstantial pairings to complete entrance into the P complex of ribosomes. Thus it is evident that building has not and cannot occur henceforward from N-terminus to C-terminus


Citations to experiments mentioned before my own.
Interference of Moonlight with the Photoperiodic Measurement of Time by Plants, and their Adaptive Reaction
Author(s): Erwin Bunning and Ilse Moser
Source: Proceedings of the National Academy of Sciences of the United States of America, Vol. 62, No. 4 (Apr. 15, 1969), pp. 1018-1022
Published by: National Academy of Sciences
The Effect of Moonlight on Activity Patterns of Adult and Juvenile Prairie Rattlesnakes (Crotalus viridis viridis)
Author(s): Jennifer A. Clarke, Joseph T. Chopko and Stephen P. Mackessy
Source: Journal of Herpetology, Vol. 30, No. 2 (Jun., 1996), pp. 192-197
Published by: Society for the Study of Amphibians and Reptiles
« Last Edit: December 02, 2009, 06:16:13 AM by Ichimaru Gin :] »
I saw a slight haze in the hotel bathroom this morning after I took a shower, have I discovered a new planet?

*

Ichimaru Gin :]

  • Undefeated FEer
  • Planar Moderator
  • 8880
  • +3/-3
  • Semper vigilans
Re: Experiment regarding the biological effects of moonlight
« Reply #1 on: November 08, 2009, 05:09:23 PM »
Circadian study is also another common topic subject to discussion in such a manner that the conclusion arises:
Quote
Light of very low intensity can indeed [or of different property] bear an effect of circadian pacemakers, particularly with the most harmful effect among plants and insects. Some would say 5 photons per second per eye for 12 hours alternating with 12 hours of darkness is suffecient of also inclimation due to moonlit effectives, to entrain normal wheel-running activity rhythms of Periplanata. Human circadian cycles have been shown to alter indebivishing 200 to 500 flux, yet that such human studies were conducted in a manner comparable to a 24-hour included with the allowance of moonlight. Previous studies show that the disruptance of the circadian cycle rhythms is related directly to the intensity of moonlight during such a phase is administered.
While it is well known that plants and insects are most prone to dangerous effects of over-exposure to moonlight, humans have been studied much less and with less detail. As for previous endeavors, humans have not shown too much of an effect on an observable cellular level. However, the point of my experiment is to observe the effects of moonlight on humans on a much broader level. Going off the basis of previous experiments, I have designed something easily repeatable and understandable to any proponent.

I have recorded various vital details of my being on three days with no moonlight exposure at night following my sleep and three nights fully exposed to the moonlight. In such a basic test, I aimed to show correlation between health of light exposures of the lunas body.
My two recordings for each day occured prior to falling to a state of sleep, and immediately afterwards.
No moonlight Exposure:

Night 1: Temp 98.2 F BP 120/77 Pulse 60 bpm
Morning 1: Temp 98.0 F BP 115/78 Pulse 55 bpm
Night 2: Temp 98.6 F BP 123/79 Pulse 62 bpm    
Morning 2: Temp 98.5 F BP 119/79 Pulse 59 bpm
Night 3: Temp 98.0 BP 117/76 Pulse 59 bpm
Morning 3: Temp 98.0 BP 117/74 Pulse 59 bpm

Moonlight Exposure:

Night 1: Temp 98.7 F BP 122/78 Pulse 61 bpm
Morning 1: Temp 98.8 F BP 125/82 Pulse 65 bpm
Night 2: Temp 98.5 F BP 118/80 Pulse 58 bpm    
Morning 2: Temp 98.5 F BP 121/82 Pulse 59 bpm
Night 3: Temp 98.3 BP 116/77 Pulse 58 bpm
Morning 3: Temp 98.6 BP 124/83 Pulse 62 bpm

Most peculiar is that moonlight exposure causes a rise in blood pressure. It is well-known that some of the most accurate BP readings occur right as someone wakes up and at that event, the BP will be shown for the most part to stay lower than that of a daily average. However, this experiment has shown otherwise and has given evidence that the moonlight causes negative effects on organisms. This includes humans. To say otherwise would be silly and a bit foolish considering the supporting data. However, these experiments and peer-reviewed articles mentioned should not be considered as insight to the extent of damage given from moonlight. The main conclusion is that there is a damaging effect that occurs.

Additional Reference:

Moonlight and Circadian Rhythms
Author(s): Rolf M. Sinclair
Source: Science, New Series, Vol. 235, No. 4785 (Jan. 9, 1987), p. 145
Published by: American Association for the Advancement of Science
« Last Edit: November 08, 2009, 05:49:02 PM by Ichimaru Gin :] »
I saw a slight haze in the hotel bathroom this morning after I took a shower, have I discovered a new planet?

*

Ichimaru Gin :]

  • Undefeated FEer
  • Planar Moderator
  • 8880
  • +3/-3
  • Semper vigilans
Re: Experiment regarding the biological effects of moonlight
« Reply #2 on: November 08, 2009, 05:57:35 PM »
My own interpretation: Exposure to moonlight is harmful to organisms. As far as humans go, it seems to me that in our current evolutionary stage, short term exposure to moonlight itself would not warrant death or other catastrophic events unless there were already major underlying health issues (discovered or not discovered) in an individual. However, if long term effects are characterized by cumulative harm, health problem risks would indeed be much higher.
I saw a slight haze in the hotel bathroom this morning after I took a shower, have I discovered a new planet?

*

Ichimaru Gin :]

  • Undefeated FEer
  • Planar Moderator
  • 8880
  • +3/-3
  • Semper vigilans
Re: Experiment regarding the biological effects of moonlight
« Reply #3 on: November 09, 2009, 07:02:57 PM »
A special thanks to Thermal Degrader for leading me to add this section.

It is well-known the benefits of sunlight. In fact, sunlight gives rise to the exact opposite effects of previous demonstrations of moonlight and promotes the health of an individual very much so that scientists conclude that by foreword alluded benefits:
Quote
  looking at deficiency of sunlight and thus of vitamin D as a factor that might influence susceptibility and thus disease incidence. Sunlight deficiency increases blood cholesterol by allowing squalene metabolism to progress to cholesterol synthesis rather than to vitamin D synthesis as would occur with greater amounts of sunlight exposure
Most of said occurences are common knowledge. Exposure to sunlight is very benficial to the health of our bodies. It reduces our blood pressure, bad cholesterol count, and improves the condition of our arteries.
For more details on the benefits of sunlight
Quote
Benefits of sunlight: a bright spot for human health..
Author(s):Mead MN.
Source:Environmental Health Perspectives [Environ Health Perspect] 2008 Apr; Vol. 116 (4), pp. A160-7. .
Publication Type:News.
Language:English.
Journal Information:Country of Publication: United States NLM ID: 0330411 Publication Model: Print Cited Medium: Print ISSN: 0091-6765 (Print) NLM ISO Abbreviation: Environ. Health Perspect. Subsets: MEDLINE
Quote
At least
1,000 different genes governing virtually
every tissue in the body are now thought to
be regulated by 1,25-dihydroxyvitamin D3
(1,25[OH]D), the active form of the vitamin,
including several involved in calcium
metabolism and neuromuscular and
immune system functioning.
Quote
The sun may be best known for boosting production of vitamin D, but there are
many other UVR-mediated effects independent of this pathway.
Direct immune suppression. Exposure to both UVA and UVB radiation can have direct
immunosuppressive effects through upregulation of cytokines (TNF-α and IL-10) and
increased activity of T regulatory cells that remove self-reactive T cells. These mechanisms
may help prevent autoimmune diseases.
Alpha melanocyte-stimulating hormone (α-MSH). Upon exposure to sunshine,
melanocytes and keratinocytes in the skin release α-MSH, which has been implicated in
immunologic tolerance and suppression of contact hypersensitivity. α-MSH also helps
limit oxidative DNA damage resulting from UVR and increases gene repair, thus reducing
melanoma risk, as reported 15 May 2005 in Cancer Research.
Calcitonin gene-related peptide (CGRP). Released in response to both UVA and UVB
exposure, this potent neuropeptide modulates a number of cytokines and is linked
with impaired induction of immunity and the development of immunologic tolerance.
According to a report in the September 2007 issue of Photochemistry and
Photobiology, mast cells (which mediate hypersensitivity reactions) play a critical role
in CGRP-mediated immune suppression. This could help explain sunlight?s efficacy in
treating skin disorders such as psoriasis.
Neuropeptide substance P. Along with CGRP, this neuropeptide is released from sensory
nerve fibers in the skin following UVR exposure. This results in increased lymphocyte
proliferation and chemotaxis (chemically mediated movement) but may also produce
local immune suppression.
Endorphins. UVR increases blood levels of natural opiates called endorphins.
Melanocytes in human skin express a fully functioning endorphin receptor system,
according to the June 2003 Journal of Investigative Dermatology, and a study published
24 November 2005 in Molecular and Cellular Endocrinology suggests that the
cutaneous pigmentary system is an important stress-response element of the skin.
Again to further with a most recent example of lowering blood pressure:
Quote
Those living without exposure to sunlight throughout
the world are at higher risk of hypertension,
and patients with cardiovascular disease
are often found to be deficient in vitamin D,
according to research by Harvard Medical
School professor Thomas J. Wang and colleagues
in the 29 January 2008 issue of
Circulation. ?Although the exact mechanisms
are poorly understood, it is known that
1,25(OH)D is among the most potent hormones
for down-regulating the blood pressure
hormone renin in the kidneys,? says Holick.
?Moreover, there is an inflammatory component
to atherosclerosis, and vascular smooth
muscle cells have a vitamin D receptor and
relax in the presence of 1,25(OH)D, suggesting
a multitude of mechanisms by which vitamin
D may be cardioprotective.?
To determine the potential link betwen
sun exposure and the protective effect in preventing
hypertension, Rolfdieter Krause of
the Free University of Berlin Department of
Natural Medicine and colleagues exposed a
group of hypertensive adults to
summer sunlight. Another group of hypertensive
adults was exposed to a tanning bed that
emitted UVA-only radiation similar to winter
sunlight. After three months, those who were exposed
to the full-spectrum of sunlight had an average
180% increase in their 25(OH)D levels and
an average 6 mm Hg decrease in their systolic
and diastolic blood pressures, bringing them
into the normal range. In constrast, the group
that used the UVA-only tanning bed showed
no change in either 25(OH)D or blood pressure.
These results were published in the
29 August 1998 issue of The Lancet.

These opposite biological effects lead to further evidence that moonlight is much different than sunlight

Sunlight, cholesterol and coronary heart disease.
Author(s):Grimes DS; Hindle E; Dyer T.
Author's Address:Department of Medicine, Blackburn Royal Infirmary, UK..
Source:QJM: Monthly Journal Of The Association Of Physicians [QJM] 1996 Aug; Vol. 89 (8 ), pp. 579-89. .
Publication Type:Journal Article; Research Support, Non-U.S. Gov't.
Language:English.
Journal Information:Country of Publication: ENGLAND NLM ID: 9438285 Publication Model: Print Cited Medium: Print ISSN: 1460-2725 (Print) Subsets: MEDLINE
« Last Edit: November 09, 2009, 07:40:37 PM by Ichimaru Gin :] »
I saw a slight haze in the hotel bathroom this morning after I took a shower, have I discovered a new planet?

*

Lord Wilmore

  • Vice President
  • Flat Earth Believer
  • 12086
  • +3/-3
Re: Experiment regarding the biological effects of moonlight
« Reply #4 on: November 10, 2009, 02:05:06 AM »
Great stuff Ichi. It's always good to see activity here in the Believers section. I think your research complements some of the work James has done very well.
"I want truth for truth's sake, not for the applaud or approval of men. I would not reject truth because it is unpopular, nor accept error because it is popular. I should rather be right and stand alone than run with the multitude and be wrong." - C.S. DeFord

*

Ichimaru Gin :]

  • Undefeated FEer
  • Planar Moderator
  • 8880
  • +3/-3
  • Semper vigilans
Re: Experiment regarding the biological effects of moonlight
« Reply #5 on: November 10, 2009, 01:04:18 PM »
CAM discussion
[reserved]
I saw a slight haze in the hotel bathroom this morning after I took a shower, have I discovered a new planet?

*

Ichimaru Gin :]

  • Undefeated FEer
  • Planar Moderator
  • 8880
  • +3/-3
  • Semper vigilans
Re: Experiment regarding the biological effects of moonlight
« Reply #6 on: November 10, 2009, 01:06:29 PM »
Great stuff Ichi. It's always good to see activity here in the Believers section. I think your research complements some of the work James has done very well.
Thank you! It was especially reassuring to see similar evidence regarding natural defense as described by James earlier.
I saw a slight haze in the hotel bathroom this morning after I took a shower, have I discovered a new planet?

*

Ichimaru Gin :]

  • Undefeated FEer
  • Planar Moderator
  • 8880
  • +3/-3
  • Semper vigilans
Re: Experiment regarding the biological effects of moonlight
« Reply #7 on: November 12, 2009, 01:17:42 PM »
Courtesy of the program Sigma Stat at Schaible Science Center:
Quote
t-test   
Data source: Data 1 in Notebook 1

Normality Test:   Passed   (P = 0.701)

Equal Variance Test:   Passed   (P = 0.423)

Group Name    N    Missing   Mean   Std Dev   SEM   
Col 1   3   0   0.1000   0.1000   0.0577   
Col 2   3   0   0.133   0.153   0.0882   

Difference   -0.0333

t = -0.316  with 4 degrees of freedom. (P = 0.768)

95 percent confidence interval for difference of means: -0.326 to 0.259

The difference in the mean values of the two groups is not great enough to reject the possibility that the difference is due to random sampling variability. There is not a statistically significant difference between the input groups (P = 0.768).

Power of performed test with alpha = 0.050: 0.050

The power of the performed test (0.050) is below the desired power of 0.800.
Less than desired power indicates you are less likely to detect a difference when one actually exists. Negative results should be interpreted cautiously.

Temperature results in my experiment are not statistically significant

Quote
t-test   
Data source: Data 1 in Notebook 1

Normality Test:   Passed   (P = 0.079)

Equal Variance Test:   Passed   (P = 1.000)

Group Name    N    Missing   Mean   Std Dev   SEM   
Col 1   3   0   -3.000   2.646   1.528   
Col 2   3   0   4.667   2.887   1.667   

Difference   -7.667

t = -3.391  with 4 degrees of freedom. (P = 0.028)

95 percent confidence interval for difference of means: -13.944 to -1.390

The difference in the mean values of the two groups is greater than would be expected by chance; there is a statistically significant difference between the input groups (P = 0.028).

Power of performed test with alpha = 0.050: 0.686

Systolic blood pressure results in my experiment are statistically significant

Quote
t-test   
Data source: Data 1 in Notebook 1

Normality Test:   Passed   (P = 0.701)

Equal Variance Test:   Passed   (P = 0.423)

Group Name    N    Missing   Mean   Std Dev   SEM   
Col 1   3   0   -0.333   1.528   0.882   
Col 2   3   0   4.000   2.000   1.155   

Difference   -4.333

t = -2.982  with 4 degrees of freedom. (P = 0.041)

95 percent confidence interval for difference of means: -8.367 to -0.299

The difference in the mean values of the two groups is greater than would be expected by chance; there is a statistically significant difference between the input groups (P = 0.041).

Power of performed test with alpha = 0.050: 0.567

Diastolic blood pressure results in my experiment are statistically significant

Quote
t-test   
Data source: Data 1 in Notebook 1

Normality Test:   Passed   (P = 0.653)

Equal Variance Test:   Passed   (P = 1.000)

Group Name    N    Missing   Mean   Std Dev   SEM   
Col 1   3   0   -2.667   2.517   1.453   
Col 2   3   0   3.000   1.732   1.000   

Difference   -5.667

t = -3.213  with 4 degrees of freedom. (P = 0.033)

95 percent confidence interval for difference of means: -10.564 to -0.769

The difference in the mean values of the two groups is greater than would be expected by chance; there is a statistically significant difference between the input groups (P = 0.033).

Power of performed test with alpha = 0.050: 0.636

Heart rate results in my experiment are statistically significant
I saw a slight haze in the hotel bathroom this morning after I took a shower, have I discovered a new planet?

*

James

  • Flat Earther
  • The Elder Ones
  • 5613
  • +1/-0
Re: Experiment regarding the biological effects of moonlight
« Reply #8 on: November 28, 2009, 06:40:40 PM »
Of course, I was greatly excited with anticipation when Ichimaru Gin announced to me the initiation of this project. He has not disappointed, the level of scientific rigor and professionalism exhibited here far exceeded my expectations. I deeply apologise for my longstanding absence, which has prevented me from expressing these sentiments, and from being present in the discourse which inevitably follows such an auspicious publication as this, however I am pleased to say that it is so exceptional and thorough as to stand up to the most scathing criticism, it is chiefly by its highly zetetic command of factual data and the analysis which accompanies it that it manifests its strength.

The ancestral zetetics would be incredibly proud of such noble dedication to the empirical pursuit of truth as has been exhibited here. Truly this study is in the spirit of our pure science.

In due course I shall be gladly entering properly into the wake of commentary which has followed I.G's work, for now I must simply express my gratitude.
"For your own sake, as well as for that of our beloved country, be bold and firm against error and evil of every kind." - David Wardlaw Scott, Terra Firma 1901

*

Ichimaru Gin :]

  • Undefeated FEer
  • Planar Moderator
  • 8880
  • +3/-3
  • Semper vigilans
Re: Experiment regarding the biological effects of moonlight
« Reply #9 on: December 01, 2009, 02:28:14 PM »
Thank you James! It was in fact your work that inspired me to look at and take interest in this subject even more.
I saw a slight haze in the hotel bathroom this morning after I took a shower, have I discovered a new planet?

*

Ski

  • Planar Moderator
  • 8781
  • +1/-2
  • Homines, dum docent, dispenguin.
Re: Experiment regarding the biological effects of moonlight
« Reply #10 on: January 23, 2010, 11:57:37 PM »
Rather fascinating.
"Never think you can turn over any old falsehood without a terrible squirming of the horrid little population that dwells under it." -O.W. Holmes "Truth forever on the scaffold, Wrong forever on the throne.."

*

sandokhan

  • Flat Earth Sultan
  • Flat Earth Scientist
  • 7272
  • +7/-39
Re: Experiment regarding the biological effects of moonlight
« Reply #11 on: February 03, 2010, 09:19:33 AM »
Mystery schools knew very well about the crystallizing force of the Moon:

But although the latter forces are active in the building of the form, they also cause death when their continued work finally crystallizes the tissues of the body.

The Sun works in the vital body and is the force which makes for life, and wars against the death-dealing Moon force.



*

17 November

  • Flat Earth Believer
  • 1337
  • +5/-2
Re: Experiment regarding the biological effects of moonlight
« Reply #12 on: February 07, 2010, 12:54:47 AM »
With all due respect, I have a question.  I do not question the facts which Ichi reports.  However, the interpretation offered by Ichi and Sandokhan which implies that the moon inherently causes damage is premature and unjustified based only upon those data.  (Don't make me go into the people who have sunstrokes down here in New Orlenas every August, etc.)  It excludes the possibility of other explanations.  Frankly, I do not believe that the moon radiates death.

In keeping with my many times previously stated view that the moon is not a reflector of the sun, as an alternative to the view that "the Sun works in the vital body and is the force which makes for life, and wars against the death-dealing Moon force," I would like to advance the view that the sun is a vehicle of fire which radiates warmth and much light.  Conversely, the moon is a vehicle much cooler and dimmer than the sun.  The moon radiates moisture.  

Fire and water are opposites.  I think the objective of any interpretation is to discover the characteristics of the sun and moon - which property is more characteristic of which rather than which is good and which is bad.  Both are good - they have different characteristics.
 
I do not know about Ichi, but it seems that Sandokhan likely had an opinion on this matter before Ichi posted these researches.  I openly confess that my prejudice stems from Saint Basil's Hexameron:

http://www.ccel.org/ccel/schaff/npnf208.viii.vii.html

(From Sections 10 & 11)
"I believe also that the variations of the moon do not take place without exerting great influence upon the organization of animals and of all living things.  This is because bodies are differently disposed at its waxing and waning.  When she wanes they lose their density and become void.  When she waxes and is approaching her fulness they appear to fill themselves at the same time with her, thanks to an imperceptible moisture that she emits mixed with heat, which penetrates everywhere.  For proof, see how those who sleep under the moon feel abundant moisture filling their heads;  see how fresh meat is quickly turned under the action of the moon;  see the brain of animals, the moistest part of marine animals, the pith of trees.  Evidently the moon must be, as Scripture says, of enormous size and power to make all nature thus participate in her changes.

  On its variations depends also the condition of the air, as is proved by sudden disturbances which often come after the new moon, in the midst of a calm and of a stillness in the winds, to agitate the clouds and to hurl them against each other; as the flux and reflux in straits, and the ebb and flow of the ocean prove, so that those who live on its shores see it regularly following the revolutions of the moon.  The waters of straits approach and retreat from one shore to the other during the different phases of the moon; but, when she is new, they have not an instant of rest, and move in perpetual swaying to and fro, until the moon, reappearing, regulates their reflux.  As to the Western sea, we see it in its ebb and flow now return into its bed, and now overflow, as the moon draws it back by her respiration and then, by her expiration, urges it to its own boundaries."

I think reflection upon more data which is collected with a view to objectively determine which of these interpretations is more justified may prove the initial conclusion about the moon's alleged inherent malignancy to have been simplistic and premature.

This much I can agree with:
Quote from: Ichimaru Gin
These opposite biological effects lead to further evidence that moonlight is much different than sunlight
Saint Basil also wrote "...For then these two luminaries are almost diametrically opposed..."

*

sandokhan

  • Flat Earth Sultan
  • Flat Earth Scientist
  • 7272
  • +7/-39
Re: Experiment regarding the biological effects of moonlight
« Reply #13 on: February 08, 2010, 09:10:09 AM »
W. Reich was the first scientist to realize that the tornadoes/hurricanes in the atmosphere and the emotional upsets use the same kind of energy; as we discussed before, there are two kinds of subquarks/preons:



On the fundamental discoveries from Occult Chemistry:

http://www.esotericscience.org/article5a.htm

www.iiyp.org/The_Amazing_Phenomenon.doc

Occult Chemistry, original format:

http://www.subtleenergies.com/ormus/oc/pdfindex.htm

The negative vortices of the Anu- constitute what we call gravity; they are emitted by the Red Moon (what is called here the Antimoon); the black Sun, emits the positive Anu+, or more commonly called vril/tummo.

On the photographs of the Black Sun:

http://theflatearthsociety.net/talk/viewtopic.php?f=7&t=1183&start=15#p34701

More on the torsion waves emitted by the Black Sun/Red Moon:

Francis Crick, codiscoverer of the DNA structure, describes this strange characteristic of the molecules of living organisms:

    It has been well known for many years that for any particular molecule only one hand occurs in nature.  For example the amino acids one finds in proteins are always what are called the L or levo amino acids, and never the D or dextro amino acids.  Only one of the two mirror possibilities occurs in proteins.

Living tissue (with the exception of some bacteria) contains only L-amino acids (laevorotatory-left handed); dead tissue only D-amino acids (dextrorotatory-right handed).


Linus Pauling, Nobel laureate in chemistry:

        This is a very puzzling fact . . . . All the proteins that have been investigated, obtained from animals and from plants, from higher organisms and from very simple organisms bacteria, molds, even viruses are found to have been made of L-amino acids.

http://creationsafaris.com/epoi_c03.htm

The Vital Body activates the positron (emissive) vortex of the aether atom, which has a left-handed motion, as compared to the electron, which rotates to the right (dextrorotatory).

A.N. Kozyrev's celebrated gyroscope experiments also show that there are two vorticular forces at work in the universe:

http://divinecosmos.com/index.php?option=com_content&task=view&id=95&Itemid=36
« Last Edit: February 08, 2010, 09:13:30 AM by levee »

*

sandokhan

  • Flat Earth Sultan
  • Flat Earth Scientist
  • 7272
  • +7/-39
Re: Experiment regarding the biological effects of moonlight
« Reply #14 on: February 08, 2010, 10:49:20 AM »
It is this dextrorotatory force which causes damage in the natural world.

The Moon (Soma-White Bindu) has been associated with the pituitary gland, the drops of Amrita (we receive through the pineal gland drops of nectar, which then constitute the hormones in the body; the pineal gland activates the pituitary gland) which feed the body (the Water-like, emotional, quality of aether).

It has a cooling effect upon the body, counterbalancing the Fire (Imagination, the Red Bindu).

The new moon energy corresponds to the end of exhalation when the force of apana is greatest. Apana is a contracting, downward moving force that makes us feel calm and grounded, but dense and disinclined towards physical exertion.

Rosicrucians say that the crystallizing forces of the moon do affect the growth stages of the vital body.





*

Ichimaru Gin :]

  • Undefeated FEer
  • Planar Moderator
  • 8880
  • +3/-3
  • Semper vigilans
I saw a slight haze in the hotel bathroom this morning after I took a shower, have I discovered a new planet?